3,646 results
-
Plasmid#221819PurposeDonor plasmid for inserting GFP11-HA to the end of Drosophila 5-HT7R coding frameDepositorInsertGFP11-HA donor with homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1AR-7xsfGFP11-HA-HDR-donor
Plasmid#221832PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1AR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1AR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2BR-7xsfGFP11-HA-HDR-donor
Plasmid#221833PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT2BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_2xFlag-dSERT-HDR-donor-HDR
Plasmid#221835PurposeDonor plasmid for inserting 2xFLAG at the beginning of Drosophila SERT coding frameDepositorInsert2xFLAG with dSERT homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1BR-7xsfGFP11-HA-HDR-donor
Plasmid#221837PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donor
Plasmid#221838PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoform D) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformBFH)-7xsfGFP11-HA-HDR-donor
Plasmid#221839PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoforms BFH) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAS-spatzle-HA
Plasmid#240235PurposeExpression of spatzle-HA under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAS-hhN-HA
Plasmid#240236PurposeExpression of hhN-HA under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorInserthedgehog N-terminal fragment (hh Fly)
TagsHA-spGFP11ExpressionInsectMutationaa 1-257PromoterUASAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUAS-CG6867-sfGFP
Plasmid#240237PurposeExpression of CG6867-sfGFP under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only