We narrowed to 60,699 results for: promoter
-
Plasmid#78768PurposeTo overexpress PPARgamma2 in Mammalian CellsDepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pNDamMyc
Plasmid#59217PurposeDrosophila DamID vector used to fuse gene of interest to Myc-tagged E.coli Dam.DepositorTypeEmpty backboneUseDamidTagsDam and MycExpressionInsectPromoterDrosophila heat-shock promoterAvailable SinceMay 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hNox5
Plasmid#69354Purposeexpresses human Nox5 in mammalian cellsDepositorAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
G-GECO1.2-Orai1
Plasmid#73562PurposeGreen fluorescent reporter of Orai1-associated calcium influxDepositorInsertG-GECO1.2-Orai1 (ORAI1 Human, Synthetic)
TagsG-GECO1.2ExpressionMammalianPromoterCMV Immediate EarlyAvailable SinceMarch 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Sestrin2
Plasmid#72593Purposeoverexpression, codon optimized for mammalian expressionDepositorInsertSESN2 (SESN2 Human)
TagsHAExpressionMammalianMutationcodon optimized for mammalian expression, see dep…PromoterCMVAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCer-C3-Plk1-K82R
Plasmid#68134PurposeExpression of Cerulean-tagged, kinase-dead Plk1 in mammalian cellsDepositorInsertPolo-like kinase 1 (PLK1 Human)
TagsCeruleanExpressionMammalianMutationK82R kinase-dead versionPromoterCMVAvailable SinceOct. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
ch-TOGKDP-GFP
Plasmid#69112PurposeFor mammalian expression of knockdown-proof human ch-TOG tagged with EGFP.DepositorInsertColonic Hepatic Tumour Over-expressed Gene (CKAP5 Human)
TagsEGFPExpressionMammalianMutationSilent mutations to confer shRNA resistance.PromoterCMVAvailable SinceOct. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
GPRC5B-Tango
Plasmid#66383PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
APJ-Tango
Plasmid#66224PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
Transposon-for RMCE_Sleeping Beauty_LIR-CAG-Frt-red(katushka)-P2A-Puro-F3-PA-RIR
Plasmid#67275PurposeFor sleeping beauty transposition and establishment of an recombinase mediated cassette exchange docking site. To make RMCE in cell line instead of flp in cell linesDepositorInsertpuromycin resistant gene
Tagslinked to red flouresent protein gene (katushka)ExpressionMammalianPromoterCAGAvailable SinceJuly 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-HshnRNPE1
Plasmid#64921PurposeExpresses V5- and SBP-tagged hnRNPE1 in mammalian cellsDepositorAvailable SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-HshnRNPC1
Plasmid#64920PurposeExpresses V5- and SBP-tagged hnRNPC1 in mammalian cellsDepositorAvailable SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-HshnRNPK
Plasmid#64923PurposeExpresses V5- and SBP-tagged hnRNPK in mammalian cellsDepositorAvailable SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
ii-Str_SBP-mCherry-GPI
Plasmid#65297Purposesynchronize trafficking of mCherry-GPI from the ER (RUSH system)DepositorInsertGPI anchor
TagsIL-2 Signal Sequence and Streptavidin Binding Pro…ExpressionMammalianPromoterCMVAvailable SinceJune 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
Ii-Str_ManII-SBP-EGFP
Plasmid#65255Purposesynchronize trafficking of ManII from the ER (RUSH system)DepositorInsertIi-Streptavidin and truncated Mannosidase II
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianMutationcontains only amino acids 1 to 116 of ManIIPromoterCMVAvailable SinceJune 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV CCTG 1200x
Plasmid#63088PurposeAdenoAssociated Virus plasmid containing expanded repeats--CCTG 1200x that correspond to Myotonic Dystrophy of type 2DepositorInsertCCUG 1200x
UseAAVExpressionMammalianPromoterCMVAvailable SinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD3 (OTU, aa 52-209)
Plasmid#61412PurposeExpresses human OTUD3 (OTU domain) in E. coli.DepositorInsertOTUD3 (OTUD3 Human)
TagsHis6-GST-3CExpressionBacterialMutationDeleted aa 1-51 and aa 210-398.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
SORT1-bio-His
Plasmid#52024PurposeExpresses full-length Sortilin precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertSORT1 (SORT1 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
CTGF-bio-His
Plasmid#52028PurposeExpresses full-length Connective tissue growth factor precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertCTGF (CCN2 Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only