We narrowed to 927 results for: plko.1
-
Plasmid#139470PurposeReplacing the RSV promoter of pLKO.1 with the CMV promoter improves lentiviral production with third-generation viral packaging system.DepositorInsertstuffer
UseLentiviral and RNAiExpressionMammalianPromoterCMVAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-CDS
Plasmid#136039PurposeG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLH-stsgRNA3.1
Plasmid#64118PurposeVector for expression of St1 sgRNA3.1 in mammalian cellsDepositorInsertSt1 sgRNA3.1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF1-CDS
Plasmid#136037PurposeUPF1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (AAGACACCTATTACACGAAGG)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-USP10-CDS
Plasmid#136057PurposeUSP10 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTATGTGGAAACTAAGTATT)DepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-USP10-3'UTR
Plasmid#136056PurposeUSP10 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTCTCTTTAGTGGCTCTTT)DepositorAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro_shTBK1_3185
Plasmid#167294PurposeLentiviral plKO.1 construct coding for a short-hairpin RNA targeting the human gene TBK1. Contains a puro resistance cassette.DepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro_shDDX58_230212
Plasmid#167293PurposeLentiviral plKO.1 construct coding for a short-hairpin RNA targeting the human gene DDX58 (coding for RLR sensor RIG-I). Contains a puro resistance cassette.DepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FOXA1_#1
Plasmid#70095PurposeExpression of shRNA to human FOXA1, puromycin selectionDepositorAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1C-YFP
Plasmid#139646PurposeReplacing the RSV promoter of pLKO.1 with the CMV promoter improves lentiviral production with third-generation viral packaging system.DepositorInsertstuffer
UseLentiviral and RNAiExpressionMammalianMutationSee Depositor commentsPromoterCMVAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GSK3β-#1
Plasmid#32496DepositorAvailable SinceSept. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #2
Plasmid#136585PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1C-shSCR
Plasmid#139472PurposeReplacing the RSV promoter of pLKO.1 with the CMV promoter improves lentiviral production with third-generation viral packaging system.DepositorInsertshSCR
UseLentiviral and RNAiExpressionMammalianPromoterCMVAvailable SinceJuly 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-mSOX9-5
Plasmid#40646DepositorAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-CDS
Plasmid#136040PurposeUPF2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCGTTATGTTTGGTGGAAGAA)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.DEST.puro
Plasmid#32682PurposeLentiviral cDNA/shRNA gateway destination vectorsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-STAU1-3'UTR
Plasmid#136049PurposeSTAU1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CCATCACCACTGCTTTCTCTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.DEST.hygro
Plasmid#32685PurposeLentiviral cDNA/shRNA gateway destination vectorsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJuly 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLKO_FOXA1_#2
Plasmid#70096PurposeExpression of shRNA to human FOXA1, puromycin selectionDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shRUNX1 puro
Plasmid#45816DepositorAvailable SinceJune 17, 2013AvailabilityAcademic Institutions and Nonprofits only