We narrowed to 1,704 results for: cag promoter
-
Plasmid#138730PurposemMoClo TUPV, with EF1alpha promoter and VP16-ZFa in the MCSDepositorInsertVP16-ZF43
UseSynthetic BiologyExpressionMammalianPromoterhEF1alphaAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE048 ZF43x6-S mKate2 (TUPV1)
Plasmid#138728PurposemMoClo TUPV, with ZF43x6-S promoter and mKate2 in the MCSDepositorInsertZF43x6-Spaced
UseSynthetic BiologyExpressionMammalianPromoterZF43x6-SpacedAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE047 ZF43x3-S mKate2 (TUPV1)
Plasmid#138727PurposemMoClo TUPV, with ZF43x3-S promoter and mKate2 in the MCSDepositorInsertZF43x3-Spaced
UseSynthetic BiologyExpressionMammalianPromoterZF43x3-SpacedAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE045 ZF43x6-C mKate2 (TUPV1)
Plasmid#138725PurposemMoClo TUPV, with ZF43x6-C promoter and mKate2 in the MCSDepositorInsertZF43x6-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x6-CompactAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE044 ZF43x3-C mKate2 (TUPV1)
Plasmid#138724PurposemMoClo TUPV, with ZF43x3-C promoter and mKate2 in the MCSDepositorInsertZF43x3-Compact
UseSynthetic BiologyExpressionMammalianPromoterZF43x3-CompactAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHIE049 ZF43x12-S mKate2 (TUPV1)
Plasmid#138729PurposemMoClo TUPV, with ZF43x12-S promoter and mKate2 in the MCSDepositorInsertZF43x12-Spaced
UseSynthetic BiologyExpressionMammalianPromoterZF43x12-SpacedAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pARA (pKD-G1)
Plasmid#62680PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP123
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pARB (pKD-G2)
Plasmid#62681PurposeMammalian expression of amiR-eGFP with a tdTomato gene from the broadly active CAG promoter/enhancerDepositorInserttdTomato/amiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pARD (pKD-G4)
Plasmid#62683PurposeMammalian expression of amiR-eGFP from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP419
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pATJ (pKD-G8)
Plasmid#62687PurposeMammalian expression of amiR-eGFP from the broadly active CAG promoter/enhancerDepositorInsertamiR-eGFP419/amiR-eGFP123
UseRNAiExpressionMammalianAvailable SinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2 probasin_mTQ2_FlpO
Plasmid#68405PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex8 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts3xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2
FlpO
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralPromoterpCMV and U6Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -EGFP
Plasmid#246994PurposeCan be used to generate AAV virus that will express EGFP from EF1α core promoterDepositorInsertEGFP
UseAAVPromoterEF1αAvailable SinceApril 10, 2026AvailabilityAcademic Institutions and Nonprofits only -
pscAAV- EF1α core -NaChBac
Plasmid#246997PurposeCan be used to generate AAV virus that will express NaChBac from EF1α core promoterDepositorInsertNaChBac
UseAAVPromoterEF1αAvailable SinceMarch 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + Z-AAT target
Plasmid#86007Purposelenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
Z-AAT target
UseLentiviralMutationV30MAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only