We narrowed to 15,000 results for: GRN
-
Plasmid#130937PurposeEngineered sgRNA-LEA1 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEA1
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY108
Plasmid#130938PurposeEngineered sgRNA-LEB1 (2 BoxB aptamers) generator circuit including promoter Plux2DepositorInsertsgRNA-LEB1
UseSynthetic BiologyExpressionBacterialPromoterPlux2Available SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH51
Plasmid#128213Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH71
Plasmid#128214Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH75
Plasmid#128224Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
PX458_BCL6_iso1_2
Plasmid#104047PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_BCL6_iso1_1
Plasmid#104046PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_TEAD3_2
Plasmid#86338PurposeEncodes gRNA for 3' target of human TEAD3DepositorInsertgRNA against TEAD3 (TEAD3 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZGPAT_2
Plasmid#86328PurposeEncodes gRNA for 3' target of human ZGPATDepositorInsertgRNA against ZGPAT (ZGPAT Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZGPAT_1
Plasmid#86327PurposeEncodes gRNA for 3' target of human ZGPATDepositorInsertgRNA against ZGPAT (ZGPAT Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFB-Puro-A
Plasmid#192506PurposeFor cloning of sgRNAs compatible with PspCas9. Contains a 5' direct repeat and a nd a unique sgRNA scaffold variant with a capture sequence. Cloning guide RNAs using BsmBI.DepositorInserthU6-sgRNA-CS1-BsmBI-EFS-Puro-WPRE
UseLentiviralPromoterhU6Available SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P POLE1_2
Plasmid#160764PurposeSuppress POLE1DepositorInsertshPOLE1_2
UseLentiviralAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only