We narrowed to 16,444 results for: GRN
-
Plasmid#193136PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA3 (GB1724) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G3aG2b.1
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
GB2879
Plasmid#193116PurposeA2 Proximal promoter sequence consisting of the target sequences for the gRNA1 (GB1838) and gRNA2 (GB1839) flanked by random sequences.DepositorInsertGB_SynP (A2) G1aG2b.5
UseSynthetic BiologyAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCK411.RR1
Plasmid#192644PurposeExpresses sgRNA RR1 (target mRFP CDS) on ColE1-AmpRDepositorInsertBBa_J23119-RR1
UseCRISPR and Synthetic BiologyPromoterBBa_J23119Available SinceNov. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY171
Plasmid#184145PurposesgRNA with 3 RNA aptemers BoxB at the 3'-end for CRISPRaDepositorInsertsgRNA-LEA2-ex3
UseSynthetic BiologyPromoterPlux2Available SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_control_NGFR
Plasmid#189800PurposeRetroviral delivery of control guide RNADepositorInsertLuciferase gRNA
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-AtpU6-29
Plasmid#160219PurposeAtpU6-29 Golden Gate level 0 piece to express gRNAsDepositorInsertpAtU6-29 promoter
UseGolden gate level 0 piece to express grnasAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-2xGFP KI
Plasmid#183443PurposeGFP knock-in for beta3-tubulin-GFP (amino acid position: stop codon)DepositorInsertgRNA and 2xGFP donor
UseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Kcnn2-smFP-myc KI
Plasmid#183438PurposeFlpON knock-in for SK2-smFP-myc (amino acid position: T571)DepositorInsertgRNA and smFP myc donor
UseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Mpp2 KI
Plasmid#183434PurposeCreOFF knock-in for GFP-MPP2 (amino acid position: A4)DepositorInsertgRNA and GFP donor
UseCRISPRExpressionMammalianAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC5 smFP-HA-Cacna1e KI
Plasmid#183441PurposeFlpOFF knock-in for smFP-HA-CaV2.3 (amino acid position: G5)DepositorInsertgRNA and smFP HA donor
UseCRISPRAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Gria1-Halo KI
Plasmid#183433PurposeCreOFF knock-in for GluA1-Halo (amino acid position: stop codon)DepositorInsertgRNA and Halo donor
UseCRISPRAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Tubb3-3xGFP KI
Plasmid#183444PurposeGFP knock-in for beta3-tubulin-GFP (amino acid position: stop codon)DepositorInsertgRNA and 3xGFP donor
UseCRISPRExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 GFP-Actb KI
Plasmid#183429PurposeCreOFF knock-in for GFP-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC4 Grin1-smFP-V5 KI
Plasmid#183439PurposeFlpON knock-in for GluN1-smFP-V5 (amino acid position: A20)DepositorInsertgRNA and smFP V5 donor
UseCRISPRExpressionMammalianAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOC2 Gria1-GFP KI
Plasmid#183430PurposeCreOFF knock-in for GluA1-GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTK73_htz-1
Plasmid#174546Purposehtz-1 targeting gRNA expressionDepositorInserthtz-1 targeting gRNA
ExpressionWormPromoterCe-U6 promoterAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-pleCopyCatcher
Plasmid#174061PurposeCopyCatcher insertion donor for the pale locusDepositorInsertPale (Pale Synthetic, Fly)
ExpressionBacterialAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only