-
Plasmid#113688PurposeSaCas9 driven by EFS. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)Available sinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Venus2-Y705F-STAT3
Plasmid#123173PurposeExpresses Y705F STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
UseTagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationY705F substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-S727A-STAT3
Plasmid#123175PurposeExpresses S727A STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
UseTagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationS727A substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 DOX off blast NFS1
Plasmid#160801PurposeExpress Dox repressible NFS1DepositorInsertNFS1 (NFS1 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro shPOLE1_1
Plasmid#160810PurposeExpress Dox repressible shPOLE1DepositorInsertshPOLE1_1
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
Venus1-K49R-STAT3
Plasmid#123166PurposeExpresses K49R STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
UseTagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationK49R substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K49R-STAT3
Plasmid#123167PurposeExpresses K49R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
UseTagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK49R substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus1-K140R-STAT3
Plasmid#123168PurposeExpresses K140R STAT3 fused to the 1-157 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus1 (aa 1-157) (STAT3 Human)
UseTagsVenus1 (aa 1-158) for bimolecular fluorescence co…ExpressionMammalianMutationK140R substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K140R-STAT3
Plasmid#123169PurposeExpresses K140R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
UseTagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK140R substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Venus2-K685R-STAT3
Plasmid#123171PurposeExpresses K695R STAT3 fused to the 158-238 fragment of Venus in mammalian cellsDepositorInsertSTAT3 tagged with Venus2 (aa 158-238) (STAT3 Human)
UseTagsVenus2 (aa 158-238) for bimolecular fluorescence …ExpressionMammalianMutationK685R substitutionPromoterAvailable sinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)Available sinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Drd1a->M71-IRES-tauGFP ACNF TV
Plasmid#105073PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-447 of Drd1a and an IRES-tauGFP followed by ACNF cassetteDepositorUseMouse TargetingTagsExpressionMutationDrd1a coding sequence followed by IRES-tauGFP ACNFPromoterAvailable sinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRTagsExpressionMammalianMutationPromoterU6FAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 - HA-KLF4 FL delta K5S
Plasmid#34594DepositorInsertKLF4 (KLF4 Human)
UseTagsHA tagExpressionMammalianMutationdeletion of K5S, corresponding to bases 1781 to 2…PromoterCMVAvailable sinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBpuro - HA KLF4 FL delta K5S
Plasmid#34592DepositorInsertKLF4 (KLF4 Human)
UseRetroviralTagsHA tagExpressionMammalianMutationdeletion of K5S, corresponding to bases 1781 to 2…PromoterLTRAvailable sinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
UseTagsExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available sinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt344A
Plasmid#34601DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseTagsExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-344 bi…PromoterCMVAvailable sinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt206B
Plasmid#34600DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseTagsExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-206 bi…PromoterCMVAvailable sinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only