We narrowed to 4,936 results for: AAT
-
Plasmid#77754Purpose3rd generation lentiviral gRNA plasmid targeting human NPR2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PRKG1 gRNA (BRDN0001146382)
Plasmid#77004Purpose3rd generation lentiviral gRNA plasmid targeting human PRKG1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
HKDC1 gRNA (BRDN0001148023)
Plasmid#76830Purpose3rd generation lentiviral gRNA plasmid targeting human HKDC1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CCM2(413-438)_pHisSUMO(K0)
Plasmid#224065PurposeBacterial expression of the C-terminal helix of CCM2 (residues 413-438) fused to an N-terminal hexa-histidine tag and SUMO(K0) [all lysines in SUMO mutated to arginines]. HRV-3C cleavage siteDepositorAvailable SinceAug. 26, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLCHKOv3-CD46 Ex3_2-Lb
Plasmid#209028PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_2-As
Plasmid#209032PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_003.gEZH2
Plasmid#220318PurposeExpresses guide RNA for CRISPR/Cas9 knockout of EZH2 for knockout/rescue experiments in mammalian cells.DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
mito-CCM2-mScarlet-I
Plasmid#208886PurposeExpress mScarlet-I-CCM2 targeted to the mitochondria in mammalian cells.DepositorInsertCCM2 (CCM2 Human)
TagsmScarlet-IExpressionMammalianMutationCCM2 targeted to the mitonchondriaAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g3 (BB36)
Plasmid#139454PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA1
Plasmid#160209PurposeKnock Down MQWSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA1 targeting collybistin MQW-CBSH3- isoforms (Plasmid # 160208).DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationGATCGGGAATGCTCaGGcTGtACC (mutations shown in lowe…Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-1-3'
Plasmid#117324PurposeCRISPR-Cas9 for miR-124-1, 3'DepositorAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.2
Plasmid#110324PurposeTRCN0000002620 (Target GCGATAAGTACCGTTGAGTTT), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHRASLS.1
Plasmid#110323PurposeTRCN0000378630 (Target GATAAGTACCGTTGAGTTTG), silence human HRASLS gene and express monomeric Kusabira-Orange2DepositorInsertHRASLS (PLAAT1 Human, Homo sapiens)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
LTK gRNA (BRDN0001145095)
Plasmid#77597Purpose3rd generation lentiviral gRNA plasmid targeting human LTKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001146383)
Plasmid#76329Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDKL4 gRNA (BRDN0001149476)
Plasmid#76108Purpose3rd generation lentiviral gRNA plasmid targeting human CDKL4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STKLD1 gRNA (BRDN0001148566)
Plasmid#75812Purpose3rd generation lentiviral gRNA plasmid targeting human STKLD1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDC42BPA gRNA (BRDN0001147767)
Plasmid#75748Purpose3rd generation lentiviral gRNA plasmid targeting human CDC42BPADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPB-TRE-V5-TurboID-linker-T2A-GR-bGH polyA > mPGK-BlastR-SV40 polyA
Plasmid#218910PurposePiggyBac transpositionDepositorInsertV5-TurboID-T2A-huGR/BlastR (NR3C1 Human)
ExpressionMammalianMutation2363G>C and 4155C>T and 4729T>G and 4731…Available SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only