We narrowed to 11,189 results for: cat.1
-
Plasmid#160427PurposeExpression of c-luciferase from sp. Kornikeria hastingsi carriebowae (Belize)DepositorInsertluciferase
UseLuciferaseTags6x Histidine tag, Yeast alpha secretion factor, c…ExpressionYeastPromoterAOXAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
p6613 MSCV-IP N-HAonly RBCK1
Plasmid#35011DepositorAvailable SinceMarch 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPKm-232
Plasmid#90501PurposepSIN - EF-1alpha - MTS tHO1 - P2A - MTS - tPCYA, vector encoding for mitochondrial-tagged Thermosynechococcus elongates Heme Oxigenase-1 (HO1) and Phycocyanobilin:ferredoxin oxireductase, under EF-1alpha promoterDepositorInsertmito-tHO1 and mito-tPCYA
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPKm-234
Plasmid#90507PurposepSIN - EF-1alpha - MTS sHO1 - P2A - MTS - sPCYA, vector encoding for mitochondrial-tagged Synechococcus sp. Heme Oxigenase-1 (HO1) and Phycocyanobilin:ferredoxin oxireductase (PcyA), under EF-1alpha promoterDepositorInsertmito-sHO1, mito-sPCYA
UseLentiviralAvailable SinceApril 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
p6615 MSCV-IP N-HAonly NIPA1
Plasmid#35013DepositorAvailable SinceFeb. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-C21orf7
Plasmid#34810DepositorAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
shMYB-2
Plasmid#247031PurposeUsed for a knockdown of MYB in human Megakaryocyte/Erythroid ProgenitorsDepositorAvailable SinceDec. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLCe PH-C
Plasmid#244967PurposeExpresses N-terminal truncation of phospholipase Ce in mammalian cells (PH domain - C-terminus)DepositorInsertphospholipase C epsilon (Plce1 Rat)
TagsFLAGExpressionMammalianMutationN-terminal truncation that removes residues 1-836PromoterCMVAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
PCDNA3.1:mTRESK
Plasmid#224771PurposeIn vitro transcription for Oocyte expression of mTRESKDepositorInsertPotassium channel subfamily member 18 (Kcnk18 Mouse)
UseIn vitro transcription for oocyte expressionPromoterT7Available SinceJan. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1:mTRESK(S116C)
Plasmid#224772PurposeIn vitro transcription for Oocyte expression of mTRESK(S116C)DepositorInsertPotassium channel subfamily member 18 (Kcnk18 Mouse)
UseIn vitro transcription for oocyte expressionMutationS116CPromoterT7Available SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:hTRAAK(S118C/Q258K)
Plasmid#224764PurposeIn vitro transcription for Oocyte expression of hTRAAK(S118C/Q258K)DepositorInsertPotassium channel subfamily member 4 (KCNK4 Human)
UseIn vitro transcription for oocyte expressionMutationS118C/Q258KPromoterT7Available SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxamEXP4CUP1
Plasmid#218284PurposeUse together with pJE13HD7 and pJE13HD7 derivatives to integrate RelE expression cassette under the control of the CUP1 promoter at ho locusDepositorInsertHph>tAgTEF1-ISceI-Repeat2-pCUP1>RelE(1-125)>RPL28intron>RelE(126, 289)>tTPI1-HO(1828, 1979)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
mCherry-NIP45 wt
Plasmid#210266PurposeInducible expression of N-terminally mCherry-tagged NIP45 wt resistant to siRNA. Use with Flp-In T-Rex system.DepositorInsertNIP45 wt siRES (NFATC2IP Synthetic)
TagsmCherryExpressionMammalianMutationsiRESPromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-NIP45 wt
Plasmid#210262PurposeInducible expression of N-terminally EGFP-tagged NIP45 wt resistant to siRNA. Use with Flp-In T-Rex system.DepositorInsertNIP45 wt siRES (NFATC2IP Synthetic)
TagsEGFPExpressionMammalianMutationsiRESPromoterCMV/TetO2Available SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
rUBR5_2383-2442_pGEX6P1
Plasmid#209791PurposeBacterial expression of UBR5 Mlle domainDepositorInsertMlle domain of UBR5 (Ubr5 Rat)
TagsGSTExpressionBacterialMutationaa 2383-2442 onlyPromotertacAvailable SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57-mini v2-HF24_F1
Plasmid#195715PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#1 of a 24 fragment split in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcdna3.1_mouseST6galI
Plasmid#178435Purposemurine St6gal1 expression plasmidDepositorInsertSt6gal1 (St6gal1 Mouse)
Tags6xHIS-TEV Cleavage SiteExpressionMammalianMutationCoding sequnce for amino acids 85-403PromoterCMVAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-aC-VTS-US
Plasmid#160425PurposeExpression of c-luciferase from sp. Vargula tsujii (USA)DepositorInsertluciferase
UseLuciferaseTags6x Histidine tag, Yeast alpha secretion factor, c…ExpressionYeastMutationSee depositor comments belowPromoterAOXAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPKm-240
Plasmid#90510PurposepSIN - EF-1alpha - Cyto -sFd - P2A - Cyto - sFNR, vector encoding for cytoplasmic-tagged Synechococcus sp. Heme Oxigenase-1 (HO1) and Phycocyanobilin:ferredoxin oxireductase (PcyA), under EF-1alpha promoterDepositorInsertcyto-sFD, cyto-sFNR
UseLentiviralAvailabilityAcademic Institutions and Nonprofits only