We narrowed to 11,628 results for: 110
-
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV5-NUP98n-CAGEn-NES (Nrdj1)
Plasmid#241418PurposeProximity-triggered Protein Trans-Splicing to generate the splice product MLL-AF9, Figure 2 & Extended Figure 4 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
M7138
Plasmid#219774PurposeMoClo-compatible Level M vector encoding hygromycin resistance cassette and a luciferase gene under control of ORCA3 promoter and terminatorDepositorInsertpNOS-HygR-ocsT | pORCA3-nnLuz-ORCA3_T
UseSynthetic BiologyExpressionPlantPromoterpNOS-HygR-ocsT | pORCA3-nnLuz-ORCA3_TAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
M7691
Plasmid#219775PurposeMoClo-compatible Level M vector encoding hygromycin resistance cassette and a luciferase gene under control of WRKY70 promoter and terminatorDepositorInsertpNOS-HygR-ocsT | pWRKY70-nnLuz-WRKY70_T
UseSynthetic BiologyExpressionPlantPromoterpNOS-HygR-ocsT | pWRKY70-nnLuz-WRKY70_TAvailable SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNK3558
Plasmid#219776PurposeMoClo-compatible Level M vector encoding hygromycin resistance cassette and a luciferase gene under control of p35S promoter and act2 terminatorDepositorInsertpNOS-HygR-ocsT | p35S-nnLuz-act2
UseSynthetic BiologyExpressionPlantPromoterpNOS-HygR-ocsT | p35S-nnLuz-act2Available SinceJuly 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-sfGFP-TurboID-ER
Plasmid#240230PurposeExpression of ER-localized sfGFP-TurboID under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertBIP-sfGFP-TurboID-KDEL
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-sfGFP-TurboID
Plasmid#240231PurposeExpression of sfGFP-TurboID under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertsfGFP-TurboID
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-Myc-BirA*G3-ER
Plasmid#240234PurposeExpression of ER-localized Myc-BirA*-G3 under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertBiP-Myc-BirA*G3-KDEL
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pWal10-roe-sfGFP
Plasmid#240239PurposeGateway destination plasmid to generate C-terminal sfGFP fusions under control of UAS promoter. Can be used to generate transgenic fly lines by white+ fly eye selection and phiC31 integration.DepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_spatzle-HA
Plasmid#240227PurposeGateway entry clone with spatzle tagged with HA (contains stop codon)DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD D262V
Plasmid#234607PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 D262V LCD (186-320)DepositorInserthnRNPA1_LCD_D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD D262N
Plasmid#234608PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 D262N LCD (186-320)DepositorInserthnRNPA1_LCD_D262N (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationC-terminal domain (186-320) bearing familial ALS …PromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD -3G1S+4V
Plasmid#234612PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 Gly and 1 Ser mutated to AsnDepositorInserthnRNPA1_LCD_4GSV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationG204V, S231V, G274V, G303VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD 5W D262V
Plasmid#234617PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262V with partial W mutantDepositorInserthnRNPA1_LCD_5W D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationF222W, F228W, Y237W, D262V, Y305W, F320WPromoterT7Available SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
p35S-FHA-AtAGO4_gDNA
Plasmid#216838PurposeN-term Flag-HA tagged Arabidopsis thaliana (Col-0) AGO4 gDNA under regulation of CaMV 35S promoterDepositorAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
SG3ΔENV CA Q67H/N74D
Plasmid#217442PurposeNon-infectious HIV-1 Clone with stop codon in Env (see NIH AIDS Reagent Program Cat #11051) and Q67H/N74D mutations in capsid (CA Q67H/N74D).DepositorInsertgag/pol
UseLentiviralMutationCA Q67H,N74DAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
CA-0251 CMVTO-c-myc-mono-hIL10 (R5A11M)-rens
Plasmid#231216Purposemyc-CleaveIL-10DepositorInsertc-myc-mono-hIL10 (R5A11M)-rens (IL10 Human)
ExpressionMammalianMutationN36I, N110I, K117N, F129LAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
CA-0091 CMVTO-mono-hIL10-R5A11M-rens-3GS-IL10Ra
Plasmid#231191PurposeCageIL-10-monomerDepositorInsertmono-hIL10-R5A11M-rens-3GS-IL10Ra (IL10 Human)
ExpressionMammalianMutationN36I, N110I, K117N, F129LAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
CA-0252 CMVTO-c-myc-mono-hIL10 (R5A11M)-rens-cleaved
Plasmid#231215PurposeCleaved-myc-IL-10DepositorInsertc-myc-mono-hIL10 (R5A11M)-rens-cleaved (IL10 Human)
ExpressionMammalianMutationN36I, N110I, K117N, F129LAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only