We narrowed to 4,356 results for: PRS;
-
Plasmid#222043PurposepGGPK-AG2 where the ccdb/CmR has been swappe for mRFP1e; Esp3I domesticated backbone.DepositorInsertmRFP1e
UseSynthetic Biology; Greengate compatible cloning v…Available SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP076
Plasmid#222028PurposeEmpty spectinomycin resistant GreenGate destination vector based on pGGP-AG. Domesticated of Esp3I sites in the backbone and chloramphenicol resistance gene.DepositorTypeEmpty backboneUseSynthetic Biology; Greengate compatible cloning v…MutationAll Esp3i sites domesticatedAvailable SinceDec. 16, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
spNW100
Plasmid#173488PurposeExpresses spNW100 in Bl21DepositorInsertspNW100
TagsHistagExpressionBacterialMutationP1049L- please see depositor commentsPromoterT7Available SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLO87
Plasmid#91726Purposemycobacterial expression of mCherry from Hsp60 promoterDepositorInserthsp60 promoter
UseMycobacterial expressionTagsmCherryPromoterhsp60Available SinceMay 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJP_Ctrl10
Plasmid#219672PurposeContains PT3lacO promoter (regulated by blue light and LacI) controlling the expression of mCherry. LacI is constitutively produced by pR promoter.DepositorInsertsmCherry
lacI
PromoterPT3lacO and pRAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-TALO8
Plasmid#83409PurposeTRP1-ARS1-8xLacO (TALO8) minichromosome system for histone purification in yeastDepositorInsertTRP-ARS-8xLacO
ExpressionYeastMutationPlease see depositor comments belowPromoterTRP1Available SinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
5T5G (SETD8)
Plasmid#101886PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceApril 30, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSG75-β2AR-T4L-sfGFP
Plasmid#102461PurposeExpresses a fusion protein of β2 adrenergic receptor/T4 lysozyme chimera and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ2AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSG74-β2AR-sfGFP
Plasmid#102460PurposeExpresses a fusion protein of wild type β2 adrenergic receptor and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ2AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSG73-β1ARts-sfGFP
Plasmid#102459PurposeExpresses a fusion protein of thermostabilized β1 adrenergic receptor and sfGFP with a C-terminal His tag. The expression is controlled by a OR2-OR1-Pr promoter.DepositorArticleInsertβ1AR
TagsHis tag and sfGFPExpressionBacterialPromoterOR2-OR1-PrAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
p201N 1510a.2
Plasmid#55770PurposeContains soybean miRNA miR1510a.2 recognition sequence (ATGGGTGGAATAGGGAAAACAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceOct. 23, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 5770
Plasmid#55772PurposeContains soybean miRNA miR5770 recognition sequence (TCTTGTCCAAACCATAGTCCAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 1510
Plasmid#55771PurposeContains soybean miRNA miR1510 recognition sequence (AGGTGGAATAGGAAAAACAACT) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 26, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
p201N 3514
Plasmid#55769PurposeContains soybean miRNA miR3514 recognition sequence (AAGGTCTCTGTCTTAATGGTGA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceAug. 21, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP074
Plasmid#222077PurposeeforRED visually marked kanamycin-resistant pVS1 plasmid backbone containing the sacB eviction marker and an excisable ccdb/CmR cassette flanked by EcoRV-HindIII restriction sites.DepositorTypeEmpty backboneUseChromoprotein-marked pvs1 backboneAvailable SinceJan. 27, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
ILID-CAAX
Plasmid#85680PurposeExpression of untagged ILID CAAXDepositorInsertILID-CAAX
ExpressionMammalianPromoterCMVAvailable SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
p201B Cas9
Plasmid#59177PurposeCas9 driven by double 35S, BAR for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
BAR
UseCRISPRPromoter2x35SAvailable SinceSept. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
p201G Cas9
Plasmid#59178PurposeCas9 driven by double 35S, GFP for plant selection, I-PpoI site to accept gRNA from pUC gRNA ShuttleDepositorInsertsCas9
sGFP
UseCRISPRPromoter2x35SAvailable SinceSept. 26, 2014AvailabilityAcademic Institutions and Nonprofits only -
MCS+
Plasmid#90412PurposeA FRET sensor that report the electric potential at the inner leaflet of cell plasma membraneDepositorInsertLck10+ Venus+mcherry+ strech of positively charged amino acids
ExpressionMammalianAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
MCS Lck only
Plasmid#90411PurposeA control of MCS+ that associated with cell plasma membrane only by one hydrophobic interaction at the N terminus of the FRET pair.DepositorInsertLck10+ Venus+mcherry
ExpressionMammalianAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAGM9121_GFP11
Plasmid#153508PurposeGFP11 C-terminal Tag Donor PlasmidDepositorInsertGFP11
UseSynthetic BiologyAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSWITCH
Plasmid#222402PurposeExpression in Streptococcus pyogenesDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP073
Plasmid#222076PurposeeforRED visually marked spectinomycin-resistant pVS1 plasmid backbone containing the sacB eviction marker and an excisable ccdb/CmR cassette flanked by EcoRV-HindIII restriction sites.DepositorTypeEmpty backboneUseChromoprotein-marked pvs1 backboneAvailable SinceJan. 27, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pVP075
Plasmid#222078PurposeAeBlue visually marked kanamycin-resistant pVS1 plasmid backbone containing the sacB eviction marker and an excisable ccdb/CmR cassette flanked by EcoRV-HindIII restriction sites.DepositorTypeEmpty backboneUseChromoprotein-marked pvs1 backboneAvailable SinceJan. 27, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
mCherry-KRasCT
Plasmid#99017PurposeMembrane markerDepositorInsertmCherry KRas CT
ExpressionMammalianPromoterCMVAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
Venus-KRasCT
Plasmid#99016PurposeMembrane markerDepositorInsertVenus KRasCT
ExpressionMammalianPromoterCMAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFBXC3GH
Plasmid#49051PurposeFX cloning insect cell expression vectorDepositorTypeEmpty backboneTags3C protease site (PreScission site), GFP, and dec…ExpressionInsectPromoterpolH (polyhedrin)Available SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAL120-modified
Plasmid#22057DepositorInsertmCMV expression cassette
UseAdenoviralAvailable SinceDec. 10, 2009AvailabilityAcademic Institutions and Nonprofits only -
pFBXC3H
Plasmid#49050PurposeFX cloning insect cell expression vectorDepositorTypeEmpty backboneTags3C protease site (PreScission site) and decaHis (…ExpressionInsectPromoterpolH (polyhedrin)Available SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only