We narrowed to 1,063 results for: CR4
-
Plasmid#123959PurposeEncodes the saCas9 CXCR1 (site 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorInsertCXCR4 sa sgRNA 3
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
SEPTOPO
Plasmid#64944Purposesource of SEP (Super Ecliptic pHluorin) sequenceDepositorInsertSEP
ExpressionBacterialPromoterlacAvailable SinceJune 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
p164 Dync1i1.B
Plasmid#26435DepositorInsertcytoplasmic dynein 1 intermediate chain 1 isoform B (Dync1i1 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 3xUTR
Plasmid#40758PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsert3 copies of the CXCR4 small RNA target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
p177 Dync1i2.C (Ex 1b)
Plasmid#26445DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform C (exon 1b) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
p169 Dync1i1.C
Plasmid#26440DepositorInsertcytoplasmic dynein 1 intermediate chain 1 isoform C (Dync1i1 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
p173 Dync1i2.A (Ex1b)
Plasmid#26443DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform A (exon 1b) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
p176 Dync1i2.B (Ex1b)
Plasmid#26444DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform B (exon 1b) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
p172 Dync1i2.E (Ex 1b)
Plasmid#26442DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform E (exon 1b) (Dync1i2 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
p171 Dync1i1.F
Plasmid#26441DepositorInsertcytoplasmic dynein 1 intermediate chain 1 isoform F (Dync1i1 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
2. p167 Dync1i1.D
Plasmid#26439DepositorInsertcytoplasmic dynein 1 intermediate chain 1 isoform D (Dync1i1 Mouse)
UseSubcloning and sequencingMutationN/AAvailable SinceMarch 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 6xUTR
Plasmid#40761PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsert6 copies of the CXCR4 small RNA target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 2xUTR
Plasmid#40757PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsert2 copies of the CXCR4 small RNA target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 4xUTR
Plasmid#40759PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsert4 copies of the CXCR4 small RNA target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 5xUTR
Plasmid#40760PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsert5 copies of the CXCR4 small RNA target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1xUTR
Plasmid#40756PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA target site
UseLuciferaseTagsluciferaseMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable SinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Control(1))-PGKpuro2AmCherry-W
Plasmid#210612PurposeLentiviral vector expressing gRNA targeting a control region at the CXCR4 locusDepositorInsertControl(1)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Control(2))-PGKpuro2AmCherry-W
Plasmid#210613PurposeLentiviral vector expressing gRNA targeting a control region at the CXCR4 locusDepositorInsertControl(2)
UseLentiviralAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only