We narrowed to 17,376 results for: por
-
Plasmid#136525PurposeUsed as a donor vector to clone into pSLIKDepositorInsertp53(R280K) (TP53 Human)
UseEntry vector for gateway cloningTagsV5Mutationp53(R280K)V5 was cloned from pLenti6-p53-R280K-V5…AvailabilityAcademic Institutions and Nonprofits only -
PB-tetO-hNIL
Plasmid#197089PurposePiggyBac plasmid with tet-inducible expression of transcription factors for motor neuron differentiationDepositorAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
CCLMPC_HA-NUP98
Plasmid#237482PurposeExpress HA-tagged NUP98 in dual promoter lentiviral vectorDepositorAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-OSKM
Plasmid#80481PurposepiggyBac transposon for dox-inducible expression of the OSKM polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ai139 (TIT2L-GFP-ICL-TPT) targeting vector
Plasmid#114426PurposeTarget a Cre-dependent GFP and a tdTomato-P2A-tTA2 expression cassette into the mouse TIGRE locusDepositorInsertGFP, tdTomato, tTA2,
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR A757
Plasmid#140829PurposeAIMTOR BRET Biosensor containing a mutated non-phosphorylable ULK1 peptide to use as a control constuct in parrallel with AIMTOR T757DepositorInsertAIMTOR A757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-HDRT-CD3z-truncCARgsg(anti-CD19)
Plasmid#215759PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2 (enhanced expression by GSG-2A linker)DepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
LIR-wtloxP-TRE-CAG-Frt-red-puro-3xPA-Frt-GFP(mVenus)-KrasG12D-cMyc-SV40LT-IRES-KRABoff-PA-TRE-loxP257-RIR
Plasmid#67277Purposeinducbile color change and cancer regulation: FlpO recombinase dependent expression of KrasG12D cMyc and SV40 large T antigen with doxycycline inducible downregulation through tetKRAB system.DepositorInsertsfirst casette contain a red fluorescent protein (katushka) linked to puromycin resitance gene through an E2A site
second cassette contains mVENUS-kras-cmyc-SV40LT-KRABoff
TagsmTQ2 blue fluorescent and red flourescent gene ka…ExpressionMammalianPromoterCAGAvailable SinceAug. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
Ai163 (TIT2L-GC6s-ICL-TPT) targeting vector
Plasmid#114430PurposeTarget a Cre-dependent GCaMP6s cassette and a tdTomato-P2A-tTA2 cassette to the mouse TIGRE locusDepositorInsertGCaMP6s, tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-HA (dark) WPRE
Plasmid#131007PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of SM_FP-HA, a cytoplasmic fluorescent protein which includes multiple HA epitope tagsDepositorInsertsmFP-HA WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsHA - 10 total HA epitope tagesExpressionMammalianMutation"dark" variant with GGG fluorphore comp…Promoternone (4x polyA to mitigate episomal expression)Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-V5 (dark) WPRE
Plasmid#131006PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of a SM_FP-V5, a cytoplasmic fluorescent protein which includes multiple V5 epitope tagsDepositorInsertsmFP-V5 WPRE
UseCre/Lox and Synthetic Biology; Mosaic analysis fo…TagsV5 - 10 total of V5 epitope tagMutation"dark" variant with GGG fluorphore comp…Promoternone (4x polyA to mitigate episomal expression)Available SinceJuly 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Ai167 (TIT2L-ChrimsonR-tdT-ICL-tTA2) targeting vector
Plasmid#114431PurposeTarget a Cre-dependent ChrimsonR-tdTomato cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertChrimsonR-tdTomato, tTA2
UseCre/Lox and Mouse TargetingPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai170 (TIT2L-ASAP2s-Kv-ICL-tTA2) targeting vector
Plasmid#114435PurposeTarget a Cre-dependent voltage sensor ASAP2s cassette into the mouse TIGRE locusDepositorInsertASAP2s-Kv, tTA2
UseCre/Lox and Mouse TargetingTagsKv2.1 tagPromoterTRE2, CAGAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
MADR pDonor smFP-Myc (dark) WPRE
Plasmid#130987PurposeMADR donor plasmid for FlpO+Cre- mediated insertion of a SM_FP-Myc, a cytoplasmic fluorescent protein which includes multiple Myc epitope tagsDepositorInsertsmFP-Myc WPRE
UseMosaic analysis for dual recombinase-mediated cas…TagsMyc - 10 total Myc tagsMutation"dark" variant with GGG fluorophore ver…Promoternone (4x polyA to mitigate episomal expression)Available SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-TAC-MKOS
Plasmid#80484PurposepiggyBac transposon for dox-inducible expression of the MKOS polycistronic reprogramming cassette (with mCherry)DepositorUsePiggybac transposonExpressionMammalianPromotertetOAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-OCT4-KLF4-cMYC
Plasmid#216175PurposeGenerate lentiviruses encoding for OCT4, KLF4 and c-MYC (polycistronic vector); used in conjunction with SOX vectors for pluripotency reprogrammingDepositorAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)_SARS-CoV-2_3CLpro_Q306A-HIS
Plasmid#224697PurposeBacterial Expression and Purification of SARS-CoV-2 3CLpro active protease with His-tagDepositorInsertSARS-CoV-2 3C-like proteinase (ORF1ab Severe acute respiratory syndrome coronavirus 2) (ORF1ab SARS-CoV-2 virus)
TagsGly-Gly-6xHisExpressionBacterialMutationsilent mutation C to T at position 10546 (elimina…PromoterT7Available SinceJuly 2, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC19-HDRT-CD3z-truncCAR(anti-CD19)
Plasmid#215758PurposeHDR template to insert a truncated CD3-zeta-deficient CD19-CAR into CD247 exon 2DepositorAvailable SinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(PAMmut)
Plasmid#176139PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resistance cassetteDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianPromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only