We narrowed to 16,217 results for: GRN
-
Plasmid#196079PurposeConstitutive CRISPRi vector conferring puromycin resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196085PurposeInducible CRISPRi vector conferring puromycin resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dSpCas9
Plasmid#92113PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDE735
Plasmid#103024Purposeexpression of a Cpf1 programming crRNA targetting CAN1, HIS4, PDR12 and ADE2 (crCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S)DepositorInsertcrCAN1-4.crHIS4-4.crPDR12-3.crADE2-3.S
UseCRISPRExpressionYeastPromoterSNR52Available SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Tbxas1
Plasmid#170305PurposeA knock-out vector for the mouse Tbxas1DepositorInsertA gRNA targeting the mouse Tbxas1 gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiguide-puro_hORAI1sg
Plasmid#174326PurposegRNA targeting hORAI1 - encodes puromycin resistanceDepositorInserthuman Orai1 (ORAI1 Human)
UseLentiviralAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pORANGE WASF1-GFP KI
Plasmid#131502PurposeEndogenous tagging of WASP1/WAVE1: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-POLI-ST2-com vector
Plasmid#176234PurposeVector plasmid for expressing spCas9-POLI fusion protein and sgRNA. There are two copies of HBB 3’ UTR in the 3’UTR of spCas9-POLI to enhance expression. The ST2 loop of the sgRNA scaffold was replaceDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-evoA1-seBEN_empty
Plasmid#174701PurposeSmall-molecule controlled base editingDepositorInsertLenti-evoA1-seBEN
UseLentiviralTagsmyc tagPromoterEFS/U6Available SinceNov. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_21B
Plasmid#91129PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9_dead + AtU6:gRNA, Plant Selection: 2x35S:hpt IIDepositorInsertEngineering Reagent: 35S:AtCas9_dead + AtU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
HeFm2SpCas9
Plasmid#92111PurposeExpression plasmid for human codon-optimized increased fidelity HeFm2SpCas9 (without U6-sgRNA coding sequence)DepositorInsert“Highly enhanced Fidelity” mut2 SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
1098A=TI-pgSIT[sxl,bTub,Hasp70Bb-Cas9]
Plasmid#149426PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel sxl and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[Sxl, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Tbxa2r
Plasmid#170304PurposeA knock-out vector for the mouse Tbxa2rDepositorInsertA gRNA targeting the mouse Tbxa2r gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_23D
Plasmid#91141PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers, Plant Selection: 2x35S:barDepositorInsertEngineering Reagent: 35S:Csy4-P2A-AtCas9_dead + CmYLCV:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFA0055
Plasmid#131774PurposeGuide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.DepositorInsert20mer CASS5a guide (gCASS5a) and 5' sgRNA
ExpressionBacterial and YeastAvailable SinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25G
Plasmid#91144PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA , Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:TaCas9_dead + TaU6:gRNA
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25I
Plasmid#91146PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone2
Plasmid#162120PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00013
Plasmid#172525PurposesgRNA against mouse Mr1DepositorAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only