We narrowed to 10,841 results for: esp
-
Plasmid#113871Purposeexpression of Cas9 programming sgRNA5 and sgRNA2 targetting HXT13-15-16 and HXT2 respectivelyDepositorInsertsgRNA5 HXT13-15-16 sgRNA2-HXT2
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDR220
Plasmid#113873Purposeexpression of Cas9 programming sgRNA8 and sgRNA7 targetting HXT10 and HXT9-11-12 respectivelyDepositorInsertsgRNA8-HXT10 sgRNA7-HXT9-11-12
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUDR295
Plasmid#113874Purposeexpression of Cas9 programming sgRNA2 and sgRNA1 targetting GAL2 and HXT4-1-5/ HXT3-6-7 respectivelyDepositorInsertsgRNA2 GAL2 sgRNA1-HXT4-1-5;HXT3-6-7
UseCRISPRExpressionYeastAvailable SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
HA-IFITM3-F8-TAG-C105A
Plasmid#122478Purposeexpresses human IFITM3-C105A with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.DepositorInsertIFITM3 (IFITM3 Human)
TagsHAExpressionMammalianMutationChanged Phenylalanine 8 to amber codon, cysteine …Available SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
HA-IFITM3-F8-TAG-C71A
Plasmid#122476Purposeexpresses human IFITM3-C71A with unnatural amino acid incorporated site specifically in response to the amber codon TAG in mammalian cells when co-transfected with tRNA synthetase/tRNA pair.DepositorInsertIFITM3 (IFITM3 Human)
TagsHAExpressionMammalianMutationChanged Phenylalanine 8 to amber codon, cysteine …Available SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
KHBD00510
Plasmid#39611DepositorAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
KHBD00413
Plasmid#34520DepositorInsertCG8365 (E(spl)m8-HLH Fly)
UseGateway CloningAvailable SinceJan. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
KHBD00624
Plasmid#39696DepositorAvailable SinceAug. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJC2297 - pHR-TRE3G-hSpCas9-NLS-FLAG-2A-Thy1.1
Plasmid#250251PurposeExpression of Cas9 with Thy1.1 cell surface marker under a doxycycline responsive promoter. Requires additional expression of transactivator.DepositorInserthSpCas9
UseCRISPR and LentiviralTagsNLS-FLAG-2A-Thy1.1PromoterTRE3GAvailable SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLIB-FLAG(N)-CDC73
Plasmid#231726PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-FLAG(N)-CDK12deltaCTD(1-1082)
Plasmid#231735PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-FLAG(N)-CDK12
Plasmid#231716PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-FLAG(N)-CDK13
Plasmid#231717PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLIB-FLAG(N)-CDK9
Plasmid#231719PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdnCas3-CDA1
Plasmid#229535PurposepMV_hyg encoding dnCas3(H74A+D75A)-CDA1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsdnCas3
Cytidine deaminase
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdnCas3-APOBEC1
Plasmid#229537PurposepMV_hyg encoding dnCas3(H74A+D75A)-rAPOBEC1 fusion construct and crRNA expression cassette. Respective crRNA spacer can be introduced via BsmBI restriction cloningDepositorInsertsrAPOBEC1
dnCas3
Uracil glycosylase inhibitor
TagsXTENExpressionBacterial and YeastMutationcodon optimized for S.cerevisiae and codon optimi…Available SinceJan. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
L2088-Mut-GPA-NLuc-Biosensor-Retrovirus-TD138
Plasmid#222876PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with split NanoLuciferase reconstitution (11S/114 fragment). Mixed WT/V84R Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA(V84R)-NanoLuc114-T2A-FKBP-GPA(WT)-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianMutationFRB chain: V84R in GPAPromoterMSCV LTRAvailable SinceAug. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSF-G1TMSNKRS
Plasmid#198323PurposetRNA synthetase/tRNA pair for the in vivo incorporation of N6-(((trimethylsilyl)methyl)carbamoyl)-L-lysine (TMSNK), into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -