We narrowed to 13,887 results for: mpl
-
Plasmid#115828PurposeEncodes codon optimized 3xFLAG-SIVAGM Vpr (MAL_ZMB) (LC114462) and puromycin resistance proteinDepositorInsertSIVAGM Vpr (MAL_ZMB) (LC114462)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS-SIV-ASC vpr
Plasmid#115824PurposeEncodes codon optimized 3xFLAG-SIVASC Vpr (KJ461715) and puromycin resistance proteinDepositorInsertSIVASC Vpr (KJ461715)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS-SIV-DEB vpr
Plasmid#115823PurposeEncodes codon optimized 3xFLAG-SIVDEB Vpr (FJ919724) and puromycin resistance proteinDepositorInsertSIVDEB Vpr (FJ919724)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS-SIV-LST vpr
Plasmid#115818PurposeEncodes codon optimized 3xFLAG-SIVLST Vpr (AF188116) and puromycin resistance proteinDepositorInsertSIVLST Vpr (AF188116)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pscALPS-SIV-MND1 vpr
Plasmid#115817PurposeEncodes codon optimized 3xFLAG-SIVMND1 Vpr (M27470) and puromycin resistance proteinDepositorInsertSIVMND1 Vpr (M27470)
UseLentiviralTags3x-FLAGPromoterSFFVAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRS406 ATG1-ATG17-3'UTR
Plasmid#166848PurposeExpresses Atg1 with ATG17 3'UTR in yeasts.DepositorAvailable SinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
mr in pUASP
Plasmid#112981PurposeP element vector for transposon insertion of mr (APC2) into Drosophila genomeDepositorInsertmr (APC2) (mr Fly)
UseP insertion vectorAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
pCFJ2210 - [1-2] ENTR - Fluor - mMaple3(1 intron, syntrons(3), no_start, no_stop)
Plasmid#159864PurposeThree-fragment Gateway compatible flourophore for expression in C. elegansDepositorInsert[1-2] ENTR - Fluor - mMaple3(1 intron, syntrons(3), no_start, no_stop)
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only