We narrowed to 16,448 results for: GRN
-
Plasmid#170302PurposeA knock-out vector for the mouse GnaqDepositorInsertA gRNA targeting the mouse Gnaq gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgAMPK alpha1 clone3
Plasmid#162121PurposeLentiviral sgRNA plasmid targeting human AMPK alpha1DepositorInsertsgAMPK alpha1 (PRKAA1 Human)
UseLentiviralAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgGFP1-7SK-sgCas9
Plasmid#87908Purposemultiple sgRNADepositorInsertsgGFP1, sgCas9
UseGateway entry vectorPromoterH1, 7SKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Cacnb1 KI
Plasmid#139660PurposeEndogenous tagging of CaVβ1: N-terminal (amino acid position: S8)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
FgH1tUTG_huMcl-1.2
Plasmid#85531PurposeInducible expression of guide RNA (huMcl-1.2) with fluorescent GFP reporterDepositorInserthu Mcl-1.2
UseCRISPR and LentiviralExpressionMammalianPromoterH1tAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B2403
Plasmid#91071PurposeModule B, Promoter: CmYLCV, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with ribozyme spacers , Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with ribozyme spacers
UseCRISPRPromoterCmYLCVAvailable SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-TLS-CsALSgR1.1
Plasmid#245877PurposeGolden gate entry vector carrying the 1st gRNA for base editing in Carrizo citrange ALS gene along with TLS mobile RNA sequenceDepositorInsertCsALSgR1.1
UseCRISPRExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B-TLS-CsALSgR1.2
Plasmid#245878PurposeGolden gate entry vector carrying the 2nd gRNA for base editing in Carrizo citrange ALS gene along with TLS mobile RNA sequenceDepositorInsertCsALSgR1.2
UseCRISPR; Golden gate entry vectorExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B-CsALSgR1.2
Plasmid#245876PurposeGolden gate entry vector carrying the 2nd gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALSgR1.2
UseCRISPR; Golden gate entry vectorExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pGGA-FT guide RNA1_7
Plasmid#246797PurposeA GreenGate entry vector containing a guide RNA expression cassette targeting the AtFT gene with 7 different gRNAsDepositorInsertAtU6-1 promoter-FT guide RNA1-AtU6-1 promoter-FT guide RNA3- (FT Synthetic, Mustard Weed)
UseCRISPR; Greengate cloning entry vectorExpressionPlantAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX458 BLTP3A knockout
Plasmid#241256PurposeKnock-out plasmid targeting the second exon of human BLTP3A (UHRF1BP1)DepositorInsertBLTP3A (UHRF1BP1) KO gRNA (BLTP3A Human)
ExpressionMammalianAvailable SinceNov. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK1841
Plasmid#239797PurposepLV-U6-[SNCAintron1 gRNA 1]-EFSNC-dSaCas9-KRAB-MeCp2-P2A-Puro-WPRE (THERAPEUTIC VECTOR)DepositorInsertpLV-U6-[SNCAintron1 gRNA 1]-EFSNC-dSaCas9-KRAB-MeCp2-P2A-Puro-WPRE
UseLentiviralPromoterCMVAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBK546
Plasmid#239839PurposepLV-U6-[hSNCA gRNA 4]-EFSNC-dSpCas9-DNMT3a-P2A-PURO-WPREDepositorInsertpLV-U6-[hSNCA gRNA 4]-EFSNC-dSpCas9-DNMT3a-P2A-PURO-WPRE
UseLentiviralPromoterCMVAvailable SinceNov. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SQLE_sg2
Plasmid#244872PurposeKnockout of human SQLEDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 SQLE_sg1
Plasmid#244871PurposeKnockout of human SQLEDepositorAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB_Mut(D1399Y)_p300_core-dCas9-EGFP_hygro
Plasmid#226427PurposePiggyBac transposon vector containing a dox inducible mutant p300 core-dCas9 fusion protein (p300 core mutation: D1399Y) and EGFP reporter. Hygromycin selection marker.DepositorInsertsMutant p300 core-dCas9-EGFP fusion protein
rtTA3-IRES-Hygro
UseCRISPR and Synthetic Biology; Piggybac transposonTagsHA tag, Mutant p300 core, and P2A-EGFPExpressionMammalianMutationp300 core mutation (D1399Y)PromoterDox inducible minimal CMV and UbC PromoterAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-0.5Syn-CasRx-pA
Plasmid#192492PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoter0.5SynAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-2
Plasmid#237891PurposeCre-KO AAV vector#2 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV-NLS-SaCas9-NLS-3xHA-bGHpA;U6-Cre-3
Plasmid#237892PurposeCre-KO AAV vector#3 containing SaCas9 and its sgRNA targeting CreDepositorInsertsgRNA-Cre
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only