We narrowed to 14,190 results for: CAN
-
Plasmid#113688PurposeSaCas9 driven by EFS. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP310-pAAV-Mecp2P-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113687PurposeSaCas9 driven by the neuron specific promoter Mecp2P. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH734-2µ-RLuc/stopCFLuc
Plasmid#40609DepositorInsertsFirefly Luciferase (nonsense mutant)
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-MTOR-D2512H
Plasmid#69017Purposeactivating MTOR mutationDepositorInsertMTOR-D2512H (MTOR Human)
TagsFLAGExpressionMammalianMutationchange Aspartate 2512 to HistidineAvailable SinceDec. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
mCherry-hPMCA2xb
Plasmid#47751Purposemammalian expression of mCherry tagged hPMCA2, xb splice variantDepositorInsertPMCA2x/b (ATP2B2 Human)
TagsmCherryExpressionMammalianMutationxb splice variantPromoterCMVAvailable SinceNov. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 - HA-KLF4 FL delta K5S
Plasmid#34594DepositorInsertKLF4 (KLF4 Human)
TagsHA tagExpressionMammalianMutationdeletion of K5S, corresponding to bases 1781 to 2…PromoterCMVAvailable SinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
Drd1a->M71-IRES-tauGFP ACNF TV
Plasmid#105073PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-447 of Drd1a and an IRES-tauGFP followed by ACNF cassetteDepositorUseMouse TargetingMutationDrd1a coding sequence followed by IRES-tauGFP ACNFAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt344A
Plasmid#34601DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-344 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt206B
Plasmid#34600DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-206 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEN243-KH217
Plasmid#224550PurposeCas9-2A-puro and sgRNA targeting the STOP codon mouse Car2DepositorInsertCas9 and sgRNA targeting the STOP codon of mouse CAR2 (Car2 Mouse)
UseCRISPRExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-PE SpG_ATH51
Plasmid#242072PurposeExpresses SpG_ATH51 prime editor and pegRNA in mammalian cellsDepositorInsertSpG_ATH51_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationectopic insertion of 7 amino acids of PID turn-he…Available SinceOct. 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-PE iSM_PPL2
Plasmid#235996PurposeExpresses iSM_PPL2 prime editor and pegRNA in mammalian cellsDepositorInsertiSM_PPL2_H840A-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsbpSV40 NLSExpressionMammalianMutationreplacement of 5 amino acids of Smac-Cas9 PL2 wit…Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1751 - pcDNA3.1 CMV-IE V5-ER-LBD
Plasmid#201818PurposeA plasmid expressing the ligand-binding domain of estrogen receptor with a V5 epitope tag from a CMV promoterDepositorInsertV5-ER-LBD
ExpressionMammalianPromoterCMV-IEAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pb-miRE-tre-3xFLAG-hnRNPU
Plasmid#196087PurposeExpresses mouse hnRNPU with a 3xFLAG tag in mammalian cellsDepositorAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pb-miRE-tre-3xFLAG-hnRNPU∆RGG
Plasmid#196088PurposeExpresses mouse hnRNPU lacking RGG domain with a 3xFLAG tag in mammalian cellsDepositorInsertSAF-A (Hnrnpu Mouse)
TagsN-terminal 3xFLAGExpressionBacterial and MammalianMutationremoved last 154 amino acids on cterminal endPromoterTREAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-safb∆sap-NLS-3XFLAG-V5
Plasmid#196091PurposeExpresses mouse SAFB lacking the n-terminal SAP domain in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tagDepositorInsertSAFB (Safb Mouse)
TagsC-terminal 3xFLAG and C-terminal V5ExpressionBacterial and MammalianMutationRemoved amino acids 31-65 (SAP domain) of mouse S…PromoterCAGGSAvailable SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only