We narrowed to 14,061 results for: CAN
-
Plasmid#78099PurposeNuclear fluorescent reporter in mammalian cells, phiC31 attB for integration, can be silenced with TetR-CR or rTetR-CR (e.g. CR can be KRAB or DNMT3B).DepositorInsertHistone H2B - Citrine (H2BC21 Synthetic, Human)
UseSynthetic BiologyExpressionMammalianPromoter5xTetO pEF alphaAvailable SinceJune 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCFJ1320
Plasmid#84829PurposeMinimos transposon with Peft-3:GFP:tbb-2 3'UTR and cbr-unc-119 selection. GFP was optimized for C. elegans, contains 2x NLS (SV40/egl-13), and smu-2 intronsDepositorInsertC. elegans codon optimized GFP
ExpressionBacterial and WormPromoterPeft-3Available SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH733-2µ-RLuc/maxCFLuc
Plasmid#40608DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pJEP325-pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
Plasmid#113702PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB. Followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV, CRISPR, and Mouse TargetingTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLD1
Plasmid#160805PurposeExpress POLD1DepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJEP310-pAAV-Mecp2P-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113687PurposeSaCas9 driven by the neuron specific promoter Mecp2P. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP311-pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113688PurposeSaCas9 driven by EFS. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTH734-2µ-RLuc/stopCFLuc
Plasmid#40609DepositorInsertsFirefly Luciferase (nonsense mutant)
Renilla luciferase
ExpressionYeastMutationAll codons of the original FLuc gene were exchang…PromoterADH1 and TDH3Available SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
mCherry-hPMCA2xb
Plasmid#47751Purposemammalian expression of mCherry tagged hPMCA2, xb splice variantDepositorInsertPMCA2x/b (ATP2B2 Human)
TagsmCherryExpressionMammalianMutationxb splice variantPromoterCMVAvailable SinceNov. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 - HA-KLF4 FL delta K5S
Plasmid#34594DepositorInsertKLF4 (KLF4 Human)
TagsHA tagExpressionMammalianMutationdeletion of K5S, corresponding to bases 1781 to 2…PromoterCMVAvailable SinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
Drd1a->M71-IRES-tauGFP ACNF TV
Plasmid#105073PurposeTargeting vector: the coding sequence of M71 is replaced by the sequence encoding amino acids 1-447 of Drd1a and an IRES-tauGFP followed by ACNF cassetteDepositorUseMouse TargetingMutationDrd1a coding sequence followed by IRES-tauGFP ACNFAvailable SinceNov. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBpuro - HA KLF4 FL delta K5S
Plasmid#34592DepositorInsertKLF4 (KLF4 Human)
UseRetroviralTagsHA tagExpressionMammalianMutationdeletion of K5S, corresponding to bases 1781 to 2…PromoterLTRAvailable SinceJan. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH752-CEN-RLuc/min103maxCFLuc
Plasmid#38218DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 103 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH751-CEN-RLuc/min53maxCFLuc
Plasmid#38217DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 53 codons of the original FLuc gene wer…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt344A
Plasmid#34601DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-344 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Report-Luc-KLF4-K5S-Mt206B
Plasmid#34600DepositorInsertKLF4 (KLF4 Human)
UseLuciferaseExpressionMammalianMutationThe KLF4 K5S region was mutated at the miR-206 bi…PromoterCMVAvailable SinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEN243-KH217
Plasmid#224550PurposeCas9-2A-puro and sgRNA targeting the STOP codon mouse Car2DepositorInsertCas9 and sgRNA targeting the STOP codon of mouse CAR2 (Car2 Mouse)
UseCRISPRExpressionMammalianAvailable SinceDec. 1, 2025AvailabilityAcademic Institutions and Nonprofits only