We narrowed to 4,923 results for: lenti sgrna
-
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide Cherry
Plasmid#170510PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and mCherry marker from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
mCherry
UseCRISPR and LentiviralExpressionMammalianPromoterEF-1a and hU6Available SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP2 (identifier AAAA-0244)
Plasmid#202553PurposeNontargeting control vector with TagBFP2DepositorInsertHumanized dCas9-KRAB-TagBFP2 (tag blue fluorescent protein 2) (TRIM28 S. Pyogenes (dCas9), H. sapiens (KRAB), Entacmaea quadricolor (TagBFP2))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2MutationPuromycin-resistance gene in the pLV hU6-sgRNA hU…Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ9834_sgBB: pHR-hU6-CasMINI sgRNA_#2; EF1a-Puro-T2A-BFP- WPRE
Plasmid#180280PurposeThe CasMINI sgRNA cloning backbone with sites 'BsmBI' for inserting new guide sequences.DepositorInsertCasMINI sgRNA (backbone) and BFP
UseLentiviralExpressionMammalianPromoterU6Available SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-Non-target sgRNA Nestin-dCas9-KRAB-T2a-GFP
Plasmid#196989PurposeDerived from pLV hU6-sgRNA Nestin-dCas9-KRAB-T2a-GFP with non-target sgRNADepositorInsertNon-Target
UseCRISPR and LentiviralAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgLenti
Plasmid#105996Purposesingle sgRNA expression vectorDepositorTypeEmpty backboneUseCRISPR and Lentiviral; S.pyogenes sgrna expressio…ExpressionMammalianPromoterU6Available SinceNov. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgMaob-HepmCherry
Plasmid#192829PurposeExpresses sgRNA targeting Maob and mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgLmnb2-HepmCherry
Plasmid#192830PurposeExpresses sgRNA targeting Lmnb2 and mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available SinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only