We narrowed to 7,952 results for: Lif
-
Plasmid#131701Purposeexpresses muSOX with GFP N-terminally fusedDepositorAvailable SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only
-
pGEX6-2 SNAP-Syk tSH2
Plasmid#113028Purposefor purification of Syk tSh2. Purified protein will have a snap tag that can be conjugated to fluorescent dyes.DepositorInsertSNAP-Syk tSH2
TagsSNAPExpressionBacterialAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
hygII-UT-ABAleon2.15
Plasmid#106983PurposeABAleon2.15 in plant expression vector (Hygromycin resistance)DepositorInsertABAleon2.1
ExpressionPlantPromoterUBQ10Available SinceJan. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP37
Plasmid#65515PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-Cit-attR1 and attR2-Cer-cMycExpressionYeastPromoterpPMA1Available SinceOct. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP36
Plasmid#65514PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-Cer-cMycExpressionYeastPromoterpPMA1Available SinceJune 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Gag-delta-p6-mEGFP
Plasmid#116890Purposeexpresses Gag missing the p6 domain, tagged with mEGFP, in mammalian cellsDepositorInsertsynthetic Gag missing the p6 domain
TagsmEGFPExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCO486
Plasmid#139729PurposeModule plasmid, individual component of Fungal Bioluminescent Pathway, NpgaDepositorInsertpMOD_A_35S Short_TMV 5':AsNpga:tAtug7
UseLuciferaseExpressionPlantPromoter35SAvailable SinceMay 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP43
Plasmid#65519PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-edAFPt9-attR1 and attR2-edCer-cMycExpressionYeastPromoterpPMA1Available SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP39
Plasmid#65517PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-edAFPt9-attR1 and attR2-t7edCFPt9-cMycExpressionYeastPromoterpPMA1Available SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
P366
Plasmid#139722PurposeModule plasmid, individual component of Fungal Bioluminescent Pathway, NpgaDepositorInsertpMOD_A''_pSlRBCS2:AsNpga:tAtuG7
UseLuciferaseExpressionPlantPromoterSlRBCS2Available SinceMay 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKL13-MgtC bb118
Plasmid#158982PurposeConstitutive expression (sigma 70 promoter) of mgtC protein from S. Typhimurium in E. coli.DepositorInsertmgtC
ExpressionBacterialPromoterBba_J23118 (sigma 70)Available SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pILAC3
Plasmid#185890PurposeIn vivo gene amplification (HapAmp) of lycopene synthetic module at RPL25 locusDepositorInsertsee comments
ExpressionYeastMutationERG20 F96C; Xd.CRtYB E83KAvailable SinceSept. 1, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIT6EG7ml
Plasmid#185886PurposeIn vivo gene amplification (HapAmp) of limonene synthetic module at RPL25 locus (14 copy).DepositorInsertsee comments
ExpressionYeastMutationERG20 F96W N127WAvailable SinceSept. 1, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
YIplac211-RPL13A-FKBPx2
Plasmid#104473PurposePlasmid for pop-in/pop-out replacement of RPL13A with an FKBPx2-tagged version.DepositorInsertRPL13Ap (RPL13A Budding Yeast)
TagsFKBPx2-HAExpressionYeastMutationincludes the last 354 bp of RPL13A onlyAvailable SinceFeb. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
mVermilion-C1
Plasmid#105756PurposeEmpty vector for creating N terminal mVermilion fusionsDepositorTypeEmpty backboneTagsmVermilionExpressionMammalianAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP42
Plasmid#65518PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-Cit-attR1 and attR2-mCer-cMycExpressionYeastPromoterpPMA1Available SinceDec. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP35
Plasmid#65513PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-TFPt9-cMycExpressionYeastPromoterpPMA1Available SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDRFLIP32
Plasmid#65511PurposeFRET biosensor Destination vector for yeast expression. Encodes a FRET pair for fusion with ligand binding domain of interest.DepositorTypeEmpty backboneTags6His-AFPt9-attR1 and attR2-t7CFPt9-cMycExpressionYeastPromoterpPMA1Available SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCL1316
Plasmid#217958PurposeExpression of human H4 tagged on its C-terminus with eGFP. Expression in mammalian cells driven by the CMV promoter.DepositorAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only