We narrowed to 1,111 results for: SAM-2;
-
Plasmid#29221PurposeExpression of the eGFP reporter gene was not detected in the brain using eGFP. Untested in the eye.DepositorAvailable SinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only
-
pEMS1407
Plasmid#29204PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1182
Plasmid#29094PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceAug. 3, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1096
Plasmid#29027PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle200 (SLC6A5 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1098
Plasmid#29029PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle202 (SLC6A5 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1391
Plasmid#29190PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1115
Plasmid#29044PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle187 (SLC6A2 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSAvailable SinceDec. 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1406
Plasmid#29203PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1393
Plasmid#29192PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1390
Plasmid#29189PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 15, 2011AvailabilityAcademic Institutions and Nonprofits only -
MoFGFR3b-SV40PA
Plasmid#86493Purposemamalian cell expression of FGFR3bDepositorInsertFgfrR3 IIIb 12F5 (Fgfr3 Mouse)
ExpressionMammalianPromoterMoloney murine leukemia virus LTRAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pD/Paro-IFN
Plasmid#205439PurposeA donor vector plasmid for Cre-mediated integration of paromomycin resistance (Paro) and dog IFNα-4 (IFNα-4) genesDepositorInsertsdog interferon α-4 gene
paromomycin resistance gene
UseCre/Lox; Chlamydomonas expressionPromoterHeat shock protein 70A (HSP70A)/ribulose bisphosp…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
MGAT2-RpHLuorin2
Plasmid#171718PurposeCis-/medial-Golgi expression of ratiometric pHLuorin2DepositorInsertRatiometric pHLuorin2 fused to MGAT2 (MGAT2 Human)
Tagsratiometric pHluorin2ExpressionMammalianPromoterCMVAvailable SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT to BioID-nDIC2-3xFlag
Plasmid#232418PurposeExpresses human dynein subunit DIC2 in mammalian cells.DepositorInsertDynein Intermediate Chain 2 (DYNC1I2 Human)
TagsBioID and Flag-3xExpressionMammalianPromoterCMVAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT to BioID-cDIC2-3xFlag
Plasmid#232416PurposeExpresses human dynein subunit DIC2 in mammalian cells.DepositorInsertDynein Intermediate Chain 2 (DYNC1I2 Human)
TagsBioID and Flag-3xExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
gCH132 (crCD55-4_crB2M-1_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217341PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertsUseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1651
Plasmid#29286PurposeExpression of the reporter gene was not detected in the brain and eye using LacZ.DepositorInsertPle179 (CLVS2 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 4, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1652
Plasmid#29287PurposeExpression of the reporter gene was not detected in the brain and eye using LacZ.DepositorInsertPle180 (CLVS2 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 4, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1653
Plasmid#29288PurposeExpression of the reporter gene was not detected in the brain and eye using LacZ.DepositorInsertPle181 (CLVS2 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceJune 10, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217342PurposecrRNA array targeting CD81, B2M, KIT, CD55DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only