We narrowed to 2,388 results for: control GFP
-
Plasmid#170083PurposeGFP expression under the control of E. coli dnaK promoter engineered with double IR2 HAIR motif from M. tuberculosisDepositorInsertGreen fluorescent protein
UseSynthetic BiologyExpressionBacterialPromoterPdnaK-IR2-IR2Available SinceSept. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TET-GFP-FF3
Plasmid#11662Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a tetracycline-responsive promoter (TET) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-GFP-FF3
Plasmid#11663Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with CMV promoter controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP-mirNega
Plasmid#163705PurposepAAV plasmid to induce expression of universal negative control micro-RNA and EGFPDepositorInsertmirNega and EGFP
UseAAVPromoterCAGAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMGS36 (GFP-ARF16-PB1)
Plasmid#126581PurposeConstruct to express GFP-ARF16-PB1 under the control of the CMV promoterDepositorInsertOsARF16-PB1 domain
TagsGFPExpressionMammalianAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_VHH-GFP4::CD8::mCherry
Plasmid#163917PurposeExpression of a membrane-tethered GFP-nanobody marked by mCherry under control of the UAS or LOP enhancersDepositorInsertFusion of vhhGPF4 nanobody with mouse CD8 transmembrane protein and mCherry fluorophor
UseCre/LoxTagsmCherryExpressionInsectAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT9650-BEAR-GFP-preedited
Plasmid#162992PurposeBEAR control plasmid with split EGFP and intact 5' splice siteDepositorInsertEGFP split with an intron between amino acids 95-96
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-EGFP-AP4-mito
Plasmid#229693PurposeTransient expression of EGFP AP4-mito in mammalian cellsDepositorInsertEGFP; Control construct with tandem AP4 motifs (mitochondria)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-TREX-GFP-FF3
Plasmid#11667Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a Tet-responsive promoter (TREX) controlling expression of GFP and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsGFPExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(-)-EGFP-AP4-cyto
Plasmid#229694PurposeTransient expression of EGFP AP4-cyto in mammalian cellsDepositorInsertEGFP; Control construct with tandem AP4 motifs (cytoplasm)
TagsEGFPExpressionMammalianPromoterCMV promoterAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p35S::SP-mCherry-GFP-HDEL
Plasmid#159097PurposePositive control for FRET in plant ER / nuclear envelope.DepositorInsertSP-mCherry-GFP-HDEL
TagsmCherry, GFPExpressionPlantPromoter35SAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_Hyg_FLAG-BirA-eGFP-NLS2
Plasmid#170917PurposeExpresses FLAG-BirA-eGFP-NLS2 to be used as control in BioID or FLAG pull downDepositorInsertFLAG-BirA-eGFP-NLS2
TagsBirA-FLAGExpressionMammalianAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-DsRed_IRES_EGFP
Plasmid#92194PurposeLentiviral overexpression vector to make stable bicistronic cell line for control (EGFP) screenDepositorInsertDsRed-IRES-EGFP
UseLentiviralExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EGFP.T2A.NCLX
Plasmid#181873PurposeExpresses EGFP and murine NCLX (separated by a T2A cleavage site) under control of the synthetic CAG promoterDepositorInsertsUseAAV and AdenoviralTagsHA and mycExpressionMammalianPromotersynthetic hybrid CAG promoter and synthetic hybri…Available SinceMarch 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLEX GFP-HA
Plasmid#229501PurposeControl HA-tagged protein for immunoprecipitation experiments.DepositorInserteGFP
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EGFP
Plasmid#166140PurposeEGFP expression under the control of the Galactose-inducible promoter yeast. Contains CEN/ARS element for low copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG426GAL-EGFP
Plasmid#166143PurposeEGFP expression under the control of the Galactose-inducible promoter in yeast. Contains 2 um element for high copy within yeast.DepositorInsertEGFP
ExpressionYeastPromoterGAL1Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUASTLOTattB_eGFP::Dpp
Plasmid#163702PurposeGFP-tagged version of Dpp (Decapentaplegic) under control of UAS and LexO enhancersDepositorAvailable SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_EGFP-P2A_truncHaus6_IRES_Blast
Plasmid#182885PurposeTransfer vector for production of lentivirus. Control plasmid for rescue experiment of HAUS6 depletion phenotype, containing a nonsense mutation and a truncation in HAUS6.DepositorInsertHAUS 6 (HAUS6 Human)
UseLentiviralExpressionBacterial and MammalianMutationstop codon introduced 2 amino acids downstream of…PromoterEF1alpha coreAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only