We narrowed to 14,348 results for: cas9
-
Plasmid#198723PurposeCas9-mediated knockout of RhoB in mammalian cells #3DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only
-
RhoC gRNA #1
Plasmid#198724PurposeCas9-mediated knockout of RhoC in mammalian cells #1DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoC gRNA #2
Plasmid#198725PurposeCas9-mediated knockout of RhoC in mammalian cells #2DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
RhoC gRNA #3
Plasmid#198726PurposeCas9-mediated knockout of RhoC in mammalian cells #3DepositorAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-Cas13d
Plasmid#224789PurposeLPUtopia matching RMCE donor plasmid with mCherry-P2A-RfxCas13d Negative-Feedback circuit. Use BlastR for positive selection and HSV-TK for negative selection.DepositorInsertmCherry-P2A-RfxCas13d
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterCMV-d2iAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
px552-sg-gria1-HT
Plasmid#187652PurposeContains HaloTag to be inserted into the NTD of Gria1 (via HITI), single guide RNA to target Cas9 to Gria1 under control of the U6 promoter, and miRFP670 under control of human synapsin promoter.DepositorInsertsHaloTag donor sequence
miRFP670
UseAAV and CRISPRTagsN/AExpressionMammalianPromoterSynapsinAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
eA3Ai-max
Plasmid#207166PurposeExpress A3A with an N57G point mutation and an intron in a BE4max-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3A (APOBEC3A Human)
TagsCas9-UGI-UGI-NLS and NLSExpressionMammalianMutationN57GPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTij_sg_mmu_Med6_C_terminal
Plasmid#197869PurposeCRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCsDepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[B]_rescue_construct
Plasmid#190638PurposePuromycin-selectable expression of HA-tagged Dora[T295M] (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
Tags3xHAExpressionInsectMutationChanged threonine 295 to methioninePromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
HA-dora[A]_rescue_construct
Plasmid#190640PurposePuromycin-selectable expression of HA-tagged truncated Dora (CG34401) in Drosophila S2 cellsDepositorInsertDorado (CG34401 Fly)
Tags3xHAExpressionInsectMutationTruncated to contain amino acids 1-945PromoterActin-5cAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA3
Plasmid#172711PurposeCas9 with 5' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorInsertmiR-290-295
UseCRISPRAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pODN-mNG-CfANLN
Plasmid#183837PurposeRepair template for the N-terminal tagging of anillin with mNeonGreen in canine cells using CRISPR/Cas9.DepositorInsertCanis familiaris ANLN homology arms with mNeonGreen-linker
UseCRISPR; Donor templateTagsmNeonGreen-linkerExpressionMammalianMutationHomology arms contain point mutations to remove t…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEGF-5’UTR
Plasmid#177260PurposeA knockout vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-dEgf
Plasmid#173700PurposeA knock-out vector for the dog EgfDepositorInsertA gRNA targeting the dog Egf gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-neo-dTgfa
Plasmid#173842PurposeA knockout vector for the dog Tgfa.DepositorInsertA gRNA targeting the dog Tgfa gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-puro-dEgfr
Plasmid#173844PurposeA knockout vector for the dog Egfr.DepositorInsertA gRNA targeting the dog Egfr gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only