We narrowed to 19,081 results for: cat
-
Plasmid#246382PurposeStable transformation or transient expression of gene if interests in plantsDepositorInsertDM2h[Bla-1] (AT3G44670 Mustard Weed)
ExpressionPlantMutationCCATTCTTAGTCACATCCTCGAA to AAAACCATTCTTGCTGCTATCC…Available SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTrcHIS2-MtFAAH1
Plasmid#243679PurposeExpresses Medicago truncatula FAAH1 isoform in E. coli.DepositorInsertMedicago truncatula Fatty Acid Amide Hydrolase 1
Tagsc-myc, 6xHISExpressionBacterialPromotertrcAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTrcHIS2-MtFAAH2a
Plasmid#243680PurposeExpresses Medicago truncatula FAAH2a isoform in E. coli.DepositorInsertMedicago truncatula Fatty Acid Amide Hydrolase 2a
Tagsc-myc, 6xHISExpressionBacterialPromotertrcAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
USP7 shRNA-TRE
Plasmid#225338PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertUSP7 shRNA (Usp7 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAcrGCas9_scr
Plasmid#207572PurposeAcrIIC1-mediated inhibition of GeoCas9 cleavage activity in E. coliDepositorInsertPrha_AcrIIC1Nme_Plac/tet_GeoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationWild-typeAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSuper DGK alfa human
Plasmid#224574PurposeTo downregulate the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_3
Plasmid#155061PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_TK1_HPRT1_Lb_2
Plasmid#155060PurposeLentiviral plasmid for expressing U6 driven multiplexed hybrid guide (hg)RNA targeting TK1 using SpCas9 and an intergenic site & HPRT1 using LbCas12a (CHyMErA system)DepositorInsert(hg)RNA targeting TK1 using SpCas9 and two intergenic sites & HPRT1 using LbCas12a
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_3x_U6_Ctnnb1_CAG_nlsTagBFP2
Plasmid#247933PurposeTargeting Ctnnb1 gene in vivo by adeno-associated viral vector-mediated deliveryDepositorInsertCtnnb1 sgRNAs (Ctnnb1 Mouse)
UseAAV, CRISPR, and Mouse TargetingTagsnls-TagBFP2ExpressionMammalianPromoterU6Available SinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAcrTCas9_scr
Plasmid#207571PurposeAcrIIC1-mediated inhibition of ThermoCas9 cleavage activity in E. coliDepositorInsertPrha_AcrIIC1Nme_Plac/tet_ThermoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationWild-typeAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHC004 (∆phaCAB)
Plasmid#226198PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator phaCAB operon, to prevent accumulation of PHB.DepositorInsertHomology arms for phaCAB
UseSynthetic BiologyAvailable SinceNov. 15, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUN1243 - pL0_pT3O (pro + 5U)
Plasmid#203891PurposeT3O promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertT3O promoter and 5'UTR
ExpressionPlantAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUN1198 - pL0_pD4H (pro + 5U)
Plasmid#203894PurposeD4H promoter and native 5'UTR (approximately 1 kb upstream of start codon) from C. roseus in a MoClo compatible L0 plasmid.DepositorInsertD4H promoter and 5'UTR
ExpressionPlantAvailable SinceApril 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGU08
Plasmid#212149PurposePlasmid expressing catalase-peroxidase and D-amino acid dehydrogenase under constitutive promoter PgyrA control. Best E. coli glycine utilization plasmid.DepositorInsertcatalase-peroxidase, D-amino acid dehydrogenase (katG katG: E. coli, dadA6: Cupriavidus necator)
ExpressionBacterialPromoterPgyrAAvailable SinceMarch 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
INT_Cargo_PgyrA_katG_dadA6
Plasmid#212142PurposeCargo plasmid for integrating PgyrA expression cassette of catalase-peroxidase and D-amino acid dehydrogenase into the genome. Plasmid can be removed by incubating cells at 37 C.DepositorInsertcatalase-peroxidase, D-amino acid dehydrogenase (katG katG: E. coli, dadA6: Cupriavidus necator)
ExpressionBacterialPromoterPgyrAAvailable SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
XLone-Puro Cas13d-eGFP U6 RUNX1 g2
Plasmid#155186PurposePiggybacTransposon-based tunable and temporal expression control of Cas13d- eGFP and RUNX1 gRNA2DepositorInsertCas13d RUNX1 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
ADRBK1 gRNA (BRDN0001145957)
Plasmid#75682Purpose3rd generation lentiviral gRNA plasmid targeting human ADRBK1DepositorInsertADRBK1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCHC024 (∆SH)
Plasmid#226202PurposeElectroporation knockout plasmid (pK18sB) to delete the C. necator soluble hydrogenase operon (deltaSH).DepositorInsertHomology arms for soluble hydrogenase operon
UseSynthetic BiologyMutation∆hoxFUYHWI ∆hypA2B2F2Available SinceNov. 18, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits