We narrowed to 35,619 results for: CaS
-
Plasmid#185376PurposeFor mammalian expression of guide RNA: TGCTGCCAAGAGGGTCAAGT that targets human MYCDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only
-
-
pFETCh_DNMT3B
Plasmid#72365PurposeDonor vector for 3' FLAG tag of human DNMT3BDepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hPKAalpha
Plasmid#185379PurposeFor mammalian expression of guide RNA: caccgTTTGAACGAATCAAGACCCT that targets human PKA subunit alphaDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330_SMAD exon 2 gRNA
Plasmid#68350Purposepx330 with gRNA towards SMAD exon 2. Cas9 is expressed from a CAG promoter.DepositorInsertSMAD exon 2 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_DNMT3B
Plasmid#72366PurposeEncodes gRNA for 3' target of human DNMT3B along with Cas9 with 2A GFPDepositorInsertDNMT3B (DNMT3B Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
px330_P53 exon 8 gRNA
Plasmid#68349Purposepx330 with gRNA towards P53 exon 8. Cas9 is expressed from a CAG promoter.DepositorInsertP53 exon 8 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330_P53 exon 7 gRNA
Plasmid#68351Purposepx330 with gRNA towards P53 exon 7. Cas9 is expressed from a CAG promoter.DepositorInsertP53 exon 7 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g2
Plasmid#153016PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing mCherryDepositorInsertTMPRSS2 gRNA
UseCRISPR and LentiviralTagsmCherryAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-BCL2L1-A1
Plasmid#188692PurposesgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
px330_PTEN exon 5 gRNA
Plasmid#68348Purposepx330 with gRNA towards PTEN exon 5. Cas9 is expressed from a CAG promoter.DepositorInsertPTEN exon 5 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGRHL2-donor
Plasmid#176351PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceNov. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCREB5-donor
Plasmid#132521PurposeCRISPR donor plasmid to create GFP fusion proteinsDepositorAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2B-donor
Plasmid#113823PurposeCRISPR donor plasmid to tag human transcription factor TFAP2B with GFPDepositorInsertTFAP2B homology arms flanking EGFP-IRES-Neo cassette (TFAP2B Human)
UseCRISPRMutationUnknownAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB12-donor
Plasmid#113802PurposeCRISPR donor plasmid to tag human transcription factor ZBTB12 with GFPDepositorInsertZBTB12 homology arms flanking EGFP-IRES-Neo cassette (ZBTB12 Human)
UseCRISPRMutationrs9267664, rs9267663Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB9.1.0-gDNA
Plasmid#112469PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB9DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZBTB5.1.0-gDNA
Plasmid#112399PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZBTB5DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
TMPRSS2 g3
Plasmid#153017PurposeA guide RNA targeting TMPRSS2 in a lentiviral plasmid co-expressing mCherryDepositorInsertTMPRSS2 gRNA
UseCRISPR and LentiviralTagsmCherryAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV-gRNA-CTBP2-MGMT_1
Plasmid#136419PurposeLentiviral expression of gRNAs targeting intron 1 of human CTBP2 and intron 1 of human MGMT. Also constitutively expresses Puromycin fused to TagBFP.DepositorInsertU6_sgRNA(CTBP2)_U6_sgRNA(MGMT)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZFX.1.0-gDNA
Plasmid#112462PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZFXDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only