We narrowed to 21,142 results for: omp
-
Plasmid#181966PurposeHuman beta actin tagged with GFP11.DepositorAvailable SinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only
-
eGFP-KCC2
Plasmid#104075Purposeexpresses rat KCC2 (b isoform) with eGFP tag at the N-terminus of KCC2DepositorInsertKCC2 (b isoform) (Slc12a5 Rat)
TagsEGFPExpressionMammalianMutationEcoR1 site in rat KCC2 was removed by silent muta…PromoterCMVAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mCherry-ATG14
Plasmid#203567PurposeMammalian expression of mCherry tagged ATG14DepositorAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
FH1-MGT#2-mCherry
Plasmid#164097PurposeFluorescent reporter for genetic tracing of mesenchymal Glioblastoma cell-state.DepositorInsertMGT#2-mCherry
UseLentiviral and Synthetic BiologyAvailable SinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO APEX2-eIF4E1
Plasmid#129644PurposeExpress APEX2 fusion to cap-binding protein eIF4E1 in mammalian cellsDepositorAvailable SinceAug. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4.TO-ORF57-2xCSTREP
Plasmid#136217PurposeExpresses C-terminally strep tagged Kaposi's Sarcoma Associated Herpesvirus (KSHV) ORF57DepositorInsertORF57
ExpressionMammalianPromoterCMVAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNH605-CCAAT-YFP
Plasmid#172132PurposeFluorescent reporter for HAP complex activityDepositorInsert4xCCAAT-YFP
UseVector for genomic integration into the yeast gen…ExpressionYeastPromoterCYC1 core promotor with 4 tandem repeats of the H…Available SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP1
Plasmid#79873PurposeBacillus subtilis dCas9 expression vector; integrates into lacA/ganADepositorInsertdCas9
UseCRISPRExpressionBacterialMutationD10A, H840APromoterxylAAvailable SinceOct. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO GFP DNAJA2
Plasmid#19492DepositorAvailable SinceOct. 6, 2008AvailabilityAcademic Institutions and Nonprofits only -
NSP6-Flag
Plasmid#210345PurposeExpresses SARS-CoV-2 NSP6 fused with Flag in mammalian cellsDepositorInsertSARS-CoV-2 NSP6 (ORF1ab SARS-CoV-2 isolate Wuhan-Hu-1, Human)
TagsFlagExpressionMammalianMutationMany synonymous changes due to codon optimizationAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
MYC-hTRAK2
Plasmid#225142PurposeExpresses MYC-tagged human TRAK2DepositorAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-miniTurbo-NES-YFP
Plasmid#127369PurposeBinary vector for expressing cytosolic miniTurbo-YFP under the UBQ10 promoter in plantsDepositorInsertminiTurbo (BirA mutant)
TagsGS linker, NES, V5, and YFPExpressionPlantMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
FP5369 KIF17MD-flag- FIREmate
Plasmid#216724PurposeExpresses motor domain of KIF17 fused to FIREmate in mamallian cellsDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
p5E--3mnx1
Plasmid#74632PurposeCan be used to drive expression specifically in zebrafish motor neuronsDepositorInsertmotor neuron and pancreas homeobox 1 promoter (mnx1 Zebrafish)
Use5' entry vector for multisite gateway three …Promoter-3mnx1Available SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Flag WDR24 pRK5
Plasmid#46334DepositorAvailable SinceJuly 15, 2013AvailabilityAcademic Institutions and Nonprofits only -
PNLM-pcABE
Plasmid#237618PurposePNLM-pcABE generated by pre-trained Protein-Nucleic Acid constrained Language Model exhibits high efficiency, a condensed editing window, and a shortened size.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPRExpressionMammalianMutationdeleted amino acids 2-8 and 147-152PromoterpCMVAvailable SinceFeb. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEBTet-SNAP-Centrobin
Plasmid#136829PurposeMammalian expression of the centrosomal protein Centrombin N-terminally fused to SNAP-tagDepositorInsertSNAP-Centrobin (CNTROB Human, Synthetic)
TagsFLAG-tag / His-tagExpressionMammalianPromoterCMV-TetO2Available SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-CasRx-P2A-mCherry-pA
Plasmid#233025PurposeTo Express HA tagged CasRX and mcherry from the mammalian EFS promoter. The CasRx and mCherry are separated by a P2A siteDepositorInsertCasRx/mCherry
UseAAVTagsmCherryAvailable SinceMarch 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-Turbo-YFP-NLS
Plasmid#127368PurposeBinary vector for expressing nuclear TurboID-YFP under the UBQ10 promoter in plantsDepositorInsertTurboID (BirA mutant)
TagsGS linker, NLS, V5, and YFPExpressionPlantMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…PromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only