We narrowed to 4,390 results for: GCA;
-
Plasmid#158779Purposeribosome-tagged, Cre-dependent GCaMP for soma localizationDepositorInsertGCaMP6m-RPL10a
UseAAVAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-SUV39h1 ts2
Plasmid#115881PurposeSUV39h1 knockdownDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR U6:gRNA cdkn2a, mitfa:Cas9
Plasmid#118842PurposeTargets cdkn2a and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorInsertcdkn2a gRNA (LOC100329528 Zebrafish)
UseCRISPR; Tol2Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRIN-shREN
Plasmid#105586PurposeDox-inducible mir30 shREN (control shRNA)/dsRED expression with Venus marker and Neo resistanceDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-Decoy
Plasmid#80324PurposeEncodes Cas9 and a CRISPR sgRNA that alleviates toxicity to Cas9 in Toxoplasma gondiiDepositorInsertDecoy sgRNA
UseCRISPRPromoterU6Available SinceSept. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJ23119-sgRNA
Plasmid#113654PurposesgRNA targeting unit plasmid. The sgRNA targeting unit plasmids contain connector ConLS, ConR1, and one sgRNA transcriptional unit.DepositorInsertpromoter J23119 and sgRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
shCDK4/6(2)
Plasmid#73555Purposevector encoding both shRNA against CDK4(2) and shRNA against CDK6(2)DepositorInsertshRNA against CDK4 + shRNA against CDK6
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYJ34-PB-CRISPR-BANCR-E1-gRNA
Plasmid#131077Purposelong non-coding RNA BANCR knock outDepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-sgUBA5
Plasmid#86132PurposeLentiviral vector expressing Cas9 and an sgRNA targeting UBA5DepositorAvailable SinceMay 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
BC1441-mouse U6-3xsgRNAs (TS5, TS6, TS7)
Plasmid#164040PurposeExpression of three sgRNAs (sgTS5, sgTS6, sgTS7) for targeting to CRISPR-Tag_V2DepositorInsertsgTS5-sgTS6-sgTS7
UseCRISPRPromotermouse U6Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
LEP-shREN
Plasmid#105580Purposeretrovirally express control shRNA with puro resistance and GFP markerDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterMSCV-LTRAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shTGFBR3 puro
Plasmid#58696PurposeLentiviral shRNA vector for knockdown of human TGFBR3DepositorAvailable SinceAug. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop B
Plasmid#171780PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-DogTag Loop B
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-CDS
Plasmid#136054PurposeCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-OSBP
Plasmid#32495DepositorAvailable SinceSept. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
MS2-adRNA (5'UAG)
Plasmid#170126PurposeLentiviral vector carrying 2 copies of the MS2 adRNA targeting a UAG at the 5' end of the ADAR2 deaminase domain in plasmids #170124 and 170125DepositorInsertMS2-ADAR2(5'UAG)-MS2
UseLentiviralExpressionMammalianPromoterHuman U6 and mouse U6Available SinceJan. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgSHMT1_1
Plasmid#106311PurposeExpress Cas9 and sgRNA targeting SHMT1DepositorInsertsgRNA targeting SHMT1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Pdha1
Plasmid#175936Purposeknockout mouse Pdha1DepositorInsertPdha1 gRNA (Pdha1 Mouse)
UseRetroviralAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRIN-E-shREN
Plasmid#105585PurposeDox-inducible mirE shREN(control shRNA)/dsRED expression with Venus marker and Neo resistanceDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only