We narrowed to 65,871 results for: des.1
-
Plasmid#163462Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADKDepositorInsertsgRNA 1 targeting NADK (NADK Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala271 hygro
Plasmid#158637PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceNov. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Gln93,Ala271 hygro
Plasmid#158638PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-His6-K2P4.1A-mCherry-StreptagII
Plasmid#158743PurposeExpresses K2P4.1 isoform A with TEV protease cleavable N- and C-terminal affinity tags.DepositorInsertK2P4.1-A (KCNK4 Human)
TagsHis6 and mCherry with Streptag IIExpressionYeastMutationResidues 1-264 with N-linked glycosylation sites …PromoterAOX1Available SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Gln93,Ala271
Plasmid#158632PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Ala148,Ala271
Plasmid#158633PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala148,Ala271 hygro
Plasmid#158639PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-MAVS-Ala148
Plasmid#158630PurposeGateway entry vector for an inducible 3xFLAG-tagged MAVS mutantDepositorAvailable SinceSept. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Ala148 hygro
Plasmid#158636PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLIK 3xFLAG-MAVS-Gln93 hygro
Plasmid#158635PurposeLentiviral expression vector for an inducible 3xFLAG-tagged MAVS mutant constructDepositorAvailable SinceSept. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-REG1-3'UTR
Plasmid#136052PurposeREG1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (ATTGTATCTCTGTAGTTTAAG)DepositorAvailable SinceMay 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pME-GalT
Plasmid#109558PurposeMultisite gateway vector for 5' tagging with the N-terminal sequence from zebrafish 1,4 galactosyltransferase 1 (GalT). Marks the Golgi complex.DepositorInsertthe N-terminal sequence from zebrafish 1,4 galactosyltransferase 1 (GalT)
UseZebrafish plasmidsAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pZS039
Plasmid#134233PurposeFor in vitro transcription of Miniata CENP-ADepositorInsertMiniata CENP-A n-terminus (nt 1-204, aa 1-68)
TagsGSTExpressionBacterialAvailable SinceFeb. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0055
Plasmid#117622PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for Sp-eCas9 1.1(pEPOR1CB0011) and sgRNA_Methyltransferase {AT5G10620}(pEPOR1CB0083)DepositorInsert[35S:Sp-eCas9 1.1(pEPOR1CB0011) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBT3038
Plasmid#122545PurposeExpression of a C. elegan codon optimized florescent protein (CemOrange2) fused to a lysosomal related organelle localized gene (glo-1) under the intestinal specific promoter nhx-2DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTOX2.1.0-gDNA
Plasmid#113787PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TOX2DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHOXB5.1.0-gDNA
Plasmid#113783PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor HOXB5DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0073
Plasmid#117640PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for Sp-eCas9 1.1(pEPOR1CB0011) and sgRNA_AtIPCS1 {AT3G54020}(pEPOR1CB0093)and sgRNA_AtIPCS1 {AT3G54020}(pEPOR1CB0104)DepositorInsert[35S:Sp-eCas9 1.1(pEPOR1CB0011) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEPOR2KN0069
Plasmid#117636PurposeLevel2 MoClo construct, containing level1 plant expression cassettes for Sp-eCas9 1.1(pEPOR1CB0011) and sgRNA_AtCas6 {AT5G04770}(pEPOR1CB0092)and sgRNA_AtCas6 {AT5G04770}(pEPOR1CB0103)DepositorInsert[35S:Sp-eCas9 1.1(pEPOR1CB0011) ] +[AtU6-26:sgRNA]
ExpressionPlantAvailable SinceNov. 16, 2018AvailabilityAcademic Institutions and Nonprofits only