We narrowed to 23,291 results for: ica;
-
Plasmid#194434PurposeRight (RR) TALEN for mutating zebrafish rif1 geneDepositorAvailable SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCS2TAL3-DD-zrif1_exon8
Plasmid#194435PurposeLeft (DD) TALEN for mutating zebrafish rif1 geneDepositorAvailable SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-shSRGAP2B/C#1-hsynapsin-EGFP
Plasmid#220796PurposeshRNA plasmid against human SRGAP2B/C genes (#1) with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TASL(FL)
Plasmid#221263PurposeExpression of TASL in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOCC240-MBP-Pab1-mCherry
Plasmid#219980PurposePab1p-mCherry protein purificationDepositorAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
actb2-SecAnxaV-mKate2-acry-EGFP
Plasmid#123628PurposeUbiquitous zebrafish expression vector containing secreted human AnnexinV tagged to mKate2. Parton lab clone BDN.DepositorInsertAnnexinA5
TagsmKate2Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPTM p62 PB1 ZZ (1-167)
Plasmid#210429PurposeBacterial expression of MBP-PB1 ZZ (1-167) with TEV cleavage siteDepositorAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPTM p62 PB1 (1-102)
Plasmid#210427PurposeBacterial expression of MBP-PB1(1-102) with TEV cleavage siteDepositorAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET22b 6His SpyCatcher-GRFT
Plasmid#204502PurposeBacterial expression of GRFT with N-terminal SpyCatcher fusion and GS linkerDepositorInsertGRFT
UseSynthetic BiologyTags6xHis and SpyCatcherExpressionBacterialPromoterT7Available SinceSept. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMUT2-pCaf-mCherry
Plasmid#192860PurposepMUT2 based vector for sensing caffeine in E. coli Nissle 1917DepositorInsertNanobody-CadC fusion protein and cognate promoter inducible by caffeine
ExpressionBacterialAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
nDHFR173-gs10-NLS-VPR
Plasmid#188262PurposePlasmid ensures constitutive expression of the N-terminal fragment of split DHFR (aa 174-186), fused to the VPR activation domain, a flexible GS linker and the SV40 NLS signal at the C-terminusDepositorInsertnDHFR173 (DHFR Human)
ExpressionMammalianAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA1
Plasmid#172709PurposeCas9 with 5' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorInsertmiR-290-295
UseCRISPRAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX458_miR-290-295KO-gRNA2
Plasmid#172710PurposeCas9 with 3' gRNA for paired CRISPR KO of miR-290-295 clusterDepositorInsertmiR-290-295
UseCRISPRAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
NAX_CAGGS_CAS9_m4_KanR neo
Plasmid#167869PurposePiggyBac compatible plasmid expressing dCas9DepositorInsertdCas9
UseCRISPRMutationD10A, D839A, H840A, N863AAvailable SinceFeb. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC8b-XII5up
Plasmid#176176Purposeyeast MoClo level-0 part plasmid type 8b containing 5' homology for integration site XII-5DepositorInsert5' homology for integration site XII-5
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC7-XII5dw
Plasmid#176177Purposeyeast MoClo level-0 part plasmid type 7 containing 3' homology for integration site XII-5DepositorInsert3' homology for integration site XII-5
UseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACEBac1-GCP4
Plasmid#178070PurposeInsect cell expression of GCP4DepositorInsertGCP4 (TUBGCP4 Human)
ExpressionInsectAvailable SinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG-DO-TC66T-mCherry
Plasmid#175178PurposeCre-off TVA-mCherry fusion protein with 66T mutationDepositorInsertTVA
UseAAVTagsmCherryMutationE66TPromoterCAGAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only