We narrowed to 17,661 results for: URE
-
Plasmid#140875PurposeMultisite Gateway middle entry vector for fusing mScarlet to the 3' end of an ORF.DepositorInsertmScarlet
UseGateway entry cloneAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SpaCas12f1-gRNA_MS13
Plasmid#190877PurposeThe plasmid of CRISPR/SpaCas12f1(Syntrophomonas palmitatica Cas12f1) for genome editing in human cellsDepositorTypeEmpty backboneUseCRISPRAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:redCas9; control_gRNA
Plasmid#199334PurposepDEL157; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous control sgRNADepositorInsertszCREST3
Cas9
control sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-SMG6-CDS-1
Plasmid#136046PurposeSMG6 shRNA (Targeting CDS #1) inserted into the PLKO.1 plasmid (AACTTGTAAGTAACCTGCAGC)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-SMG6-CDS-2
Plasmid#136047PurposeSMG6 shRNA (Targeting CDS #2) inserted into the PLKO.1 plasmid (AAGGAGTTCCAGGTGTTACTG)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTYB3-PUM1-HD
Plasmid#17543DepositorAvailable SinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Control-PTEN-3'UTR-Wt
Plasmid#21326DepositorAvailable SinceJune 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
p15a-AsCas12f-apmR
Plasmid#171610PurposeAsCas12f1-based K. pneumoniae genome editingDepositorInsertAsCas12f1
ExpressionBacterialAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICH47732:FCP:NAT
Plasmid#85984PurposeGolden Gate Level 1 cassette encoding a Nat selectable marker under the FCP promoterDepositorInsertNAT
UseGolden gate assemblyPromoterFCPAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2 Notch1 ICv-6MT
Plasmid#41730DepositorInsertNotch-1 Intracellular Domain (Notch1 Mouse)
Tags6xMycExpressionMammalianMutationContains murine Notch-1 protein beginning at Valiā¦Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only