We narrowed to 19,341 results for: Comp;
-
Plasmid#195732PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#18 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F1
Plasmid#195715PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#1 of a 24 fragment split in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F9
Plasmid#195723PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#9 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F23
Plasmid#195737PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#23 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUC57-mini v2-HF24_F21
Plasmid#195735PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#21 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceFeb. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MS2-HA-HsRck_296-472_AC
Plasmid#148419PurposeMammalian Expression of HsRck_296-472DepositorInsertHsRck_296-472 (DDX6 Human)
ExpressionMammalianAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL1RN gRNA_1-MS2-Puro
Plasmid#192677PurposeLentiviral expression of sgRNA targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNA #1 (IL1RN Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MBP-ATG9-Q835A
Plasmid#188081PurposeExpresses human ATG9-Q835A mutant in mammalian cellsDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MBP-ATG9-K838A
Plasmid#188078PurposeExpresses human ATG9-K838A mutant in mammalian cellsDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MBP-ATG9-V839A
Plasmid#188077PurposeExpresses human ATG9-V839A mutant in mammalian cellsDepositorAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShuttle.CC9
Plasmid#192931PurposeGateway compatible vector with BsaI cloning site and Cre-2A-Cas9 expressionDepositorTypeEmpty backboneUseGateway-compatible cloning vectorPromoterCMVAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1d63C + VP2C-GFPdeg
Plasmid#182481PurposeYIp for expressing Murine polyomavirus deltaVP1 with the 63 C-ter residues truncated (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
deltaVP1d63C
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1 and GAL10Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked VLP NES
Plasmid#182432PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and fusion protein VP2C-ERG20-AcNES1 (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-FPPS-NES
deltaVP1
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1 and GAL10Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked VLP NES (M)
Plasmid#182434PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and fusion protein VP2C-ERG20(F96W-N127W)-AcNES1 (GAL10 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(M)-NES
deltaVP1
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1 and GAL10Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Linked VLP NES (G)
Plasmid#182476PurposeYIp for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and fusion protein VP2C-ERG20(F96C)-AcNES1 (GAL10 promoter). Contains uracil marker (K. lactis URA3).DepositorInsertsVP2C-FPPS(G)-NES
deltaVP1
UseSynthetic Biology; Metabolic engineeringExpressionYeastPromoterGAL1 and GAL10Available SinceDec. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p21StBD
Plasmid#190269PurposeConstitutively expresses a protein of interest fused to a GAL4 DNA-binding domain. Targeted integration to genomic locus YPRC-tau 3, Chromosome XVI.DepositorTypeEmpty backboneUseSynthetic Biology; Yeast genome-integrating vectorTagsGAL4-BDPromoterTDH3Available SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-GST-hFIP200(Delta641-779, 1363-1370Mut)-MBP
Plasmid#190039PurposeExpression of FIP200 mutantDepositorInsertFIP200 (RB1CC1 Human)
TagsGST and MBPExpressionMammalianMutation(641-779)deletion & 1363 RDKDLIES 1370 to GSSā¦PromoterCMVAvailable SinceNov. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-MS2-HA-C1-HsGIGYF1_1-671-del286-316_AI
Plasmid#148959PurposeMammalian Expression of HsGIGYF1_1-671-del286-316DepositorInsertHsGIGYF1_1-671-del286-316 (GIGYF1 Human)
ExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-V5-SBP-C1-HsGIGYF1_1-671-del286-316_AI
Plasmid#148963PurposeMammalian Expression of HsGIGYF1_1-671-del286-316DepositorInsertHsGIGYF1_1-671-del286-316 (GIGYF1 Human)
ExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only