We narrowed to 25,353 results for: Spr
-
Plasmid#211819Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line extablishmentDepositorInsertSpCas9, tracrRNA and blasticidin resistance gene
UseLentiviralExpressionMammalianPromoterU1a promoter and miniU6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS2194-RP_PiggyBac_SpCas9ABE8e-tracrRNA-Puro
Plasmid#211821PurposePiggyBac vector expressing SpCas9-ABE8e with tracrRNA for stable cell line establishmentDepositorInsertSpCas9-ABE8e, tracrRNA and Puromycin resistance gene
ExpressionMammalianPromoterchicken β-actin promoter, U6 promoter and hPGK pr…Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ03-pLenti-U1a-mSpCas9-U6-tracrRNA-PuroR
Plasmid#211815Purposelentiviral vector expressing SpCas9 and tracrRNA for stable cell line establishmentDepositorInsertSpCas9, tracrRNA and puromycin selection gene
UseLentiviralExpressionMammalianPromoterU1a promoter, U6 promoter, and hPGK promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-miniTurbo-LMNB1
Plasmid#207774PurposeDonor template for Blast-2A-miniTurbo insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-miniTurbo Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Solo-mScarlet-ACTB
Plasmid#207750PurposeDonor template for mScarlet insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a mScarlet Tag (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Solo-mNeon-ACTB
Plasmid#207749PurposeDonor template for mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a mNeon Tag (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-DCK-Hygro
Plasmid#202409PurposegRNA expression vector for DCKDepositorAvailable SinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPV-C1-crRNA(DMD#20_DMD#23)-EF1a-BA
Plasmid#204620PurposeExpression vector of crRNA (DMD#20) targeting the dystrophin intron 44 just upstream of exon 45, and crRNA(DMD#23)targeting the dystrophin intron 55 just downstream of exon 55. Blasticidin selectable.DepositorInsertcrRNA#20 (targeting DMD intron44) and crRNA#23 (targeting DMD intron 55)
UseCRISPRPromoterU6Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-RBMS3
Plasmid#185557PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting RBMS3DepositorInsertRBMS3 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-HHIP
Plasmid#185551PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting HHIPDepositorInsertHHIP gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-ADGRG6
Plasmid#185554PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting ADGRG6DepositorInsertADGRG6 gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dCas9_sgRNA Td2
Plasmid#176258PurposepNOC episomal plasmid harboring the dead version of humanized spCas9 gene sequence tagged with Nlux and sgRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInsertdead spCas9
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationH840A and D10A mutations on spCas9 to inactivate …Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_dfnCas12a_crRNA Td2
Plasmid#176255PurposepNOC episomal plasmid harboring the dead version of humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the fluorescent gene tdtomato with spacer 2DepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseMutationD917A and E1006A mutations to inactivate the endo…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA sCRNA 2.0 (GB2461)
Plasmid#160593PurposeVersion of the native Cas9-sgRNA with one native WT aptamer sequence and F6 aptamer sequence recognized for Ms2 coat protein, in 3'.DepositorInsertsgRNA sCRNA 2.0
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 U6-26-1gRNA-DFR 2.1 (GB1838)
Plasmid#160625PurposeGB-cassette for the expression of a guide RNA targeting the DFR promoter with 2.1 Ms2 aptamer in the 3' of the scaffoldDepositorInsertU6-26-1gRNA-DFR 2.1
UseCRISPR and Synthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterU6-26Available SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 sgRNA:scaffold tetraloop MS2 aptamer SAM (GB1436)
Plasmid#160570PurposeA version of scaffold sgRNA with the sequence of MS2 aptamer inside the tetraloop of the scaffoldDepositorInsertsgRNA:scaffold tetraloop MS2 aptamer SAM
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP319-pAAV-U6SaCas9gRNA(emx1sg2)-EFS-GFP-KASH-pA
Plasmid#113696PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP318-pAAV-U6SaCas9gRNA(emx1sg1)-EFS-GFP-KASH-pA
Plasmid#113695PurposeU6 driven SaCas9 gRNA expression cassette with a gRNA targeting EMX1, followed by an EFS driven GFP-KASH in a separate reading frame.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pETM6-1D4-mCherry
Plasmid#73423PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 1D4.DepositorInsertPromoter 1D4 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP1D4 (orthogonal T7-lac variant)Available SinceMarch 4, 2016AvailabilityAcademic Institutions and Nonprofits only