We narrowed to 11,984 results for: SOM
-
Plasmid#225707PurposePan-neuronal soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV1InsertASAP5-Kv2.1
UseAAVPromoterhuman synapsinAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTUM4
Plasmid#230905PurposePlasmid encoding four periplasmic folding helper proteins to boost the secretion of functional heterologous proteins in E. coliDepositorInsertsExpressionBacterialAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-Dio-ASAP5-Kv2.1-WPRE
Plasmid#225708PurposeCre dependent soma-targeted expression of the genetically encoded voltage indicator ASAP5DepositorHas ServiceAAV9InsertASAP5-Kv2.1
UseAAVPromoterEF1αAvailable SinceOct. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP SNAP23
Plasmid#101914PurposeExpresses SNAP23 in mammalian cellsDepositorAvailable SinceOct. 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-EGFP-NLS-P2AT2A-mCherry-PTS1
Plasmid#87828PurposeHigh-efficient mammalian expression vector for co-expression of EGFP-tagged and mCherry-tagged proteins using P2AT2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-mTagBFP2-FRB-Rab7
Plasmid#214273PurposeMammalian expression of mTagBFP2-FRB-Rab7 (late endosome marker)DepositorAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GCaMP 6m-p2A-ChRmine-Kv2.1-WPRE
Plasmid#131004Purposebicistronic AAV vector to express GCaMP6m and soma-targeted ChRmine under the control of human Synapsin promoterDepositorHas ServiceAAV8InsertChRmine
UseAAVTagsKv2.1-HAPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP SNAP47
Plasmid#101915PurposeExpresses SNAP47 in mammalian cellsDepositorAvailable SinceMarch 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTag-RFP-C-h-Rab11a
Plasmid#79806PurposeExpress TagRFP labeled human Rab11a (GTPase located on recycling endosomal membranes).DepositorAvailable SinceJuly 22, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-EGFP-NLS-P2A-mCherry-PTS1
Plasmid#87803PurposeMammalian expression vector template for co-expression of EGFP-tagged and mCherry-tagged proteins using P2A. NLS and PTS1 can be replaced by proteins of interest.DepositorInsertsNLS
PTS1
TagsEGFP and mCherryExpressionMammalianPromoterCMV promoter, tetracycline operatorAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
PMP34-mApple
Plasmid#214417PurposePeroxisome localization of PMP34 fused to mAppleDepositorAvailable SinceJune 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP Cep170 (Nigg PID200)
Plasmid#41150DepositorAvailable SinceJune 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-Dlx-SynaptoTAG
Plasmid#210729PurposeAAV vector for mapping synaptic projections. GABAergic neuron-specific Dlx promoter expresses EGFP-Synaptobrevin-2 to label synaptic terminals and Palm-tdTomato to label neuronal soma and axons.DepositorInsertEGFP-Synaptobrevin-2, P2A, Palm-tdTomato (tdTomato with Palmitoylation sequence) (Vamp2 Synthetic, Rat)
UseAAVPromoterDlxAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pF(UG) hSyn LAMP1-msGFP (JV012)
Plasmid#179728PurposeLentiviral expression of LAMP1-msGFP for use as a lysosomal markerDepositorInsertLAMP1 (Lamp1 Mouse)
UseLentiviralAvailable SinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRibo-Sec-APEX2m
Plasmid#176844PurposeExpression of APEX2 in the periplasm from a codon-optimized gene (multi-copy episomal plasmid)DepositorInsertpRibo-Sec-APEX2m
UseInducibleExpressionBacterialPromoterpRibo, theophilline riboswitch inducible hsp60 pr…Available SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB80-KIF1A(1-365)-VVDfast-mVenus-SSPB(micro)_P2A_iLID-mCherry-RAB11
Plasmid#174644PurposeOptogenetic coupling of RAB11 to opto-kinesin to induce anterograde transport of recycling endosomesDepositorInsertKIF1A(1-365)-VVDfast-mVenus-SSPB(micro)-P2A-iLID-mCherry-RAB11
TagsVenus-SSPB and iLID-mCherryExpressionMammalianMutationmmKIF1A(aa1-365): Pro202Ala; mVenus: Met1Del, Thr…PromoterChicken beta-actinAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_CRATES
Plasmid#176251PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and type IIS restriction site for endonuclease BaeI at the crRNA region that facilitates the generation of mulitplDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
GST scFv [N100/13]
Plasmid#190521PurposeMammalian Expression of GST scFV. Derived from hybridoma N100/13.DepositorInsertGST (Schistosoma japonicum) recombinant scFV
TagsHA, Sortase, 6xHisExpressionMammalianPromoterCMVAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAC150-KEIMA-VAPA
Plasmid#212096PurposeFluorescent reporter for VAPA clearance to acidic lysosomesDepositorAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only