We narrowed to 2,557 results for: GCG
-
Plasmid#246565PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd8 gRNADepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pTol1-U6abc_amhc(myh6)_cmlc2-nmKate
Plasmid#238375PurposeDrives expression of 3 different gRNAs targeting amhc (myh6), and expression of nclear mKate in cardiomyocytes.DepositorInsertnuclear mKate/3 gRNAs targeting amhc
Promotercmlc2 (nmKate); U6 (gRNAs)Available SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Cd109 gRNA
Plasmid#246571PurposeCRISPR vector co-expressing Cas9 and a mouse Cd109 gRNADepositorAvailable SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
bRA66-deltaMic60
Plasmid#245524PurposeEdited bRA66 containing gRNA to create S. cerevisiae deltaMic60 and S. cerevisiae Mic60(1-317)DepositorAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX458-ARHGEF7/B-Pix
Plasmid#241368PurposeMammalian expression of SpCas9 and gRNA targeting ARHGEF7 (β-Pix)DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-30kb-DSF
Plasmid#227483Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-30kb-DSF
Plasmid#227484Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-30kb-DSF
Plasmid#227485Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 30kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-48kb-DSF
Plasmid#227495Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 48kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-51kb-DSF
Plasmid#227496Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 51kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-66kb-DSF
Plasmid#227497Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 66kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-18kb-USF
Plasmid#227469Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 28kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-14kb-USF-1-6
Plasmid#227470Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-11kb-USF
Plasmid#227473Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 11kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-3.3kb-USF
Plasmid#227475Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 3.3kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-58kb-USF
Plasmid#227457Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 58kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_051d_sgCiChr2-2
Plasmid#228940PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertsgChr2-2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
pGL3-Ctr1-gRNA-EGFP
Plasmid#226000PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Ctr2-gRNA-EGFP
Plasmid#226001PurposeNegative control for CRISPRi-KDDepositorInsertnegtive control sgRNA of no specific targets in human genome
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-NCL-gRNA1-EGFP
Plasmid#226004PurposeCRISPRi-KD of human NucleolinDepositorInsertsgRNA targeting human Nucleolin (NCL Human)
ExpressionMammalianAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA_SOX2_HDR
Plasmid#163752PurposegRNA expression vector to target the SOX2 stop codon for HDR gene tagging in human cells.DepositorAvailable SinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-DHX58-ts3
Plasmid#174246PurposeDHX58 knockdownDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 ANXA2 g2
Plasmid#170827PurposePiggyBac Cas13d sgRNA plasmid for ANXA2 knockdownDepositorInsertCas13d ANXA2 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458-SPNS1-sg2
Plasmid#198567PurposeSPNS1-targeting sgRNA in PX458 vectorDepositorAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA242
Plasmid#215943PurposeFragmid fragment: (guide cassette) guide expression; positive control cell surfaceDepositorHas ServiceCloning Grade DNAInsertU6_v1; sgCD47_v1 [Sp]; trRNA_v4 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only