We narrowed to 11,840 results for: CHL
-
Plasmid#184327PurposeMammalian expression of the nuclear localized YFP-CCTd(peptide of Cav1.2)DepositorInsertCCTc (CACNA1C Human)
ExpressionMammalianAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11
Plasmid#154025PurposeBichromatic Fluorescent Splicing Reporter Minigene for Wild-Type BAP1 Exon 11DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7
Plasmid#154023PurposeBichromatic Fluorescent Splicing Reporter Minigene for Wild-Type BAP1 Exon 7DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgRNA targeting human SLC12A5 gene stop codon
Plasmid#158577PurposeFor generate double-strand DNA break near the stop codon of the human SLC12A5 gene that encodes neuronal chloride transporter KCC2 protein.DepositorInsertsgRNA targeting human SLC12A5 gene stop codon
UseCRISPRTagsCas9 and GFPExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterConstitutive wild-type S. pyogenes promoterAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNeg-Ma-barnase-TAG3-TAG45
Plasmid#197572PurposeNegative selection plasmid for selecting ncAA-encoding Methanomethylophilus alvus Pyl-RS mutants. Expresses 2xTAG-codon interrupted barnase gene and M. alvus Pyl-tRNA(6). p15a origin of replication.DepositorInsertsBarnase - 2xTAG
M. alvus Pyl-tRNA (6)
TagsnoneExpressionBacterialMutation3TAG and 45TAGPromoteraraC and lppAvailable SinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BAP1_WT
Plasmid#81852PurposeGateway Donor vector containing BAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
plenti-FLAG-CAMK2D
Plasmid#221699PurposeLentiviral expression of FLAG-tagged human CAMK2D in mammalian cellsDepositorInsertCAMK2D (CAMK2D Human)
UseLentiviralAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianAvailable SinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
Cavbeta1 Ca2+ channel scFv [N7/18]
Plasmid#206789PurposeMammalian Expression of Cavbeta1 Ca2+ channel scFV. Derived from hybridoma N7/18 scFv.DepositorInsertCavbeta1 Ca2+ channel (Homo sapiens) recombinant scFV (CACNB1 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChR2(H134R)-eYFP
Plasmid#127090PurposeCre-dependent AAV expression of humanized ChR2 (with H134R mutation) fused to eYFP for optogenetic activationDepositorHas ServiceAAV PHP.eBInsertChannelrhodopsin-2
UseAAVTagseYFP (C terminal on insert)ExpressionMammalianMutationHumanized ChR2 gene with histidine 134 changed to…PromoterCAGAvailable SinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304-GW-DCK*-IRES-GFP
Plasmid#176291PurposeGateway vector for use in generating POI-DCK* fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304-DCK*-GW-IRES-GFP
Plasmid#176289PurposeGateway vector for use in generating DCK*-POI fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only