We narrowed to 24,950 results for: Spr
-
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR_Wheat_live_Cas9
Plasmid#126880PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and BpiI sites for sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-T2A-Puro
Plasmid#101039PurposeEnhanced SpCas9(1.1) with puromycin resistance gene via T2A linker.DepositorTypeEmpty backboneUseCRISPRTags3xFLAG and T2A-PuroExpressionMammalianPromoterCBhAvailable SinceNov. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti.Cas9.BFP.Blast
Plasmid#196714PurposeWT SpCas9 with BSD-TagBFP for selection and sortingDepositorInsertCas9-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX551-miniCMV-SpCas9
Plasmid#107031PurposeAAV plasmid expressing Cas9 under control of miniCMV promoterDepositorInsertSpCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
lenti-RfxCas13d-Blast-BFP
Plasmid#196726PurposeSortable and selectable RfxCas13d.DepositorInsertRfxCas13d-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsSV40 NLSPromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-miRFP670
Plasmid#91854PurposeCas9 from S. pyogenes with 2A-miRFP670, and cloning backbone for sgRNA. Modified Zhang Plasmid #62988DepositorInsertshSpCas9-2A-miRFP670
BB-guide RNA
UseCRISPRTags2A-miRFP670 and 3XFLAGExpressionMammalianPromoterCbh and U6Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX551-CMV-CjCas9
Plasmid#107035PurposeAAV plasmid expressing CjCas9 under control of CMV promoterDepositorInsertCjCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 5' Npm1 gRNA
Plasmid#127900PurposeWT Cas9 Vector targeting the 5' end of the mouse Npm1 geneDepositorInsertgRNA/Cas9
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-dCas9-VPR-wpA-pPuroTK
Plasmid#214127PurposeGene expression by Piggybac transposase in mammalian cellsDepositorInsertdCas9-VPR
UseCRISPRExpressionMammalianMutationCodon-optimized for mammalian cellsAvailable SinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-dCas9-KRAB_Hygro
Plasmid#192663Purpose3rd generation lenti vector encoding dCas9-KRAB with 2A Hygro resistance markerDepositorInsertdCas9-KRAB
UseCRISPR and LentiviralExpressionMammalianMutationD10A, D839A, H840A and N863A in Cas9PromoterEF1aAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-VP64-dCas9-VP64-ZsG
Plasmid#192668PurposeDox-inducible expression of VP64-dCas9-VP64 with 2A ZsGreen1DepositorInsertVP64-dCas9-VP64, ZsGreen1
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterTRE3GAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROPSeq-PP7-p65-HSF
Plasmid#196719PurposeCROP-Seq library plasmid for CRISPR-A with SAM system (p65-HSF1 activator recruited to PP7 binding loops in the tracrRNA of the guide).DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
1782_pAAV-U6-Ai9-Sa-gRNA2-CB-SACas9-HA-OLLAS-spA_C
Plasmid#135978PurposegRNA against the right loxP site of the Ai9 alleleDepositorInsertAi9 gRNA2
UseAAV, CRISPR, and Mouse TargetingTagsHAPromoterCBAvailable SinceJan. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHnS 2comp Donor;smFP-V5 KO;Template ORF0
Plasmid#240304PurposeDonor:smFP-V5 KO:TemplateDepositorInsertTemplate gRNA
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX601-miniCMV-SaCas9-U6-LacZvsSaCas9 sgRNA
Plasmid#107049PurposeAll-in-one vectors expressing both SaCas9 and LacZ sgRNADepositorInsertSaCas9
UseAAV and CRISPRExpressionMammalianAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHR Ef1a-dCas9-BFP-KRAB
Plasmid#217304Purposelentiviral vector for dCas9-BFP-KRAB on Ef1alpha promoterDepositorInsertdCas9-tagBFP-KRAB
UseCRISPR, Lentiviral, and Synthetic BiologyPromoterEf1alphaAvailable SinceApril 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330 Mouse 3' Hp1a gRNA
Plasmid#127898PurposeWT Cas9 Vector targeting the 3' end of the mouse Hp1a geneDepositorInsertgRNA/Cas9
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pnos-Fok1:dCas9-nos
Plasmid#62210PurposeExpresses Fok1:dCas9 under control of nanos promoter and 3'UTR. For germ line restricted high specificity genome engineering in Drosophila melanogaster.DepositorInsertFok1-dCas9
ExpressionInsectPromoternanosAvailable SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only