We narrowed to 42,160 results for: TRO
-
Plasmid#185860PurposeTesting the SkGAL2 promoter inserted with 4 Z268 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2+[Z268]>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF72 (B9)
Plasmid#185858PurposeTesting the SkGAL2 promoter inserted with 2 PZ4 element using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M5(5*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10CF72
Plasmid#185857PurposeTesting the SkGAL2 promoter inserted with 4 PZ4 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M4(4*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10E1B
Plasmid#185856PurposeTesting the SkGAL2 promoter inserted with 3 PZ4 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M2(3*PZ4)>(BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP10E1A
Plasmid#185855PurposeTesting the SkGAL2 promoter inserted with 2 PZ4 elements using a green fluorescent protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1- PSkGAL2M1(2*PZ4)> (BamHI)yEGFP>TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pILGFP3A2 (1)
Plasmid#185851PurposeTesting the TEF1 promoter appended with 2 tetracycline riboswitch using a green fluorescence protein as the reporterDepositorInsertPURA3>KlURA3>TAgTEF1-PTEF1>2*TcRb>yEGFP>TPGK1-TURA3
ExpressionYeastMutationNoneAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMLS538
Plasmid#188881PurposeGateway Entry Vector [1-2]: 2xNLS::Cas9 (with 4 introns from smu-2)DepositorInsertCas9
UseGateway entry vectorMutationC. elegans codom optimization and intron additionAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-Myo1b motor
Plasmid#187364PurposeExpresses rat myosin 1b isoform b motor domain labelled with EGFPDepositorAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
rtTA-sg-CMV51
Plasmid#188484PurposegRNA plasmid with neomycin resistance expressing a single guide RNA targeting cytomegaloviral promoter site 51.DepositorInsertCMV promoter sgRNA
UseCRISPRExpressionMammalianMutationNonePromoterU6Available SinceAug. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA(BbsI)-PGKpuro2ABFP-L1mono3
Plasmid#73542PurposeExpression of sgRNA targeting LINE-1 and TagBFPDepositorInsertLINE-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV-U6gRNA(BbsI)-PGKpuro2ABFP-L1mono1
Plasmid#73543PurposeExpression of sgRNA targeting LINE-1 and TagBFPDepositorInsertLINE-1
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-T11HA-hMOV10-CD
Plasmid#178908Purposeexpression of catalytic dead hMOV10 K530ADepositorInsertcDNA Catalytic dead hMOV10 (MOV10 Human)
TagsT11 beta strand of GFP-HAExpressionMammalianMutationK530A catalytic dead AAG>GCAPromoterCMV protmoterAvailable SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ammB3
Plasmid#167815PurposeExpresses His6-tagged AmmB3 in E. coliDepositorInsertAmmB3
TagsHis6ExpressionBacterialPromoterT7Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28a-ammC1
Plasmid#167816PurposeExpresses His6-tagged AmmC1 in E. coliDepositorInsertAmmC1
TagsHis6ExpressionBacterialPromoterT7Available SinceAug. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
PDEST-pSP172BSSPE-pFOGc::RfA-HA
Plasmid#186406PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9341 (pgRNA_IX-1_NatMX)
Plasmid#161593PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site IX-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9343 (pgRNA_XV-1_NatMX)
Plasmid#161595PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XV-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9358(VII-1_Markerfree_BackBone)
Plasmid#161599PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site VII-1, (Chr VII: 438509..438490)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9359(VIII-1_Markerfree_BackBone)
Plasmid#161600PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site VIII-1, (Chr VIII: 293615..293634)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only