We narrowed to 2,135 results for: rp1
-
Plasmid#47736PurposeExpresses enzymatically monobiotinylated full-length MSRP1 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised MSRP1
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRS314-PRP16
Plasmid#89971PurposePrp16 in a trp backbone complements prp16 genomic deletionDepositorAvailable SinceOct. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYC6H-TRP1URA3
Plasmid#11009DepositorInsertPgal1TRP1URA3
TagsV5 and his6ExpressionBacterial and YeastMutationORF-TRP1 fused to ORF-URA without stop codonAvailable SinceDec. 29, 2005AvailabilityAcademic Institutions and Nonprofits only -
pDonr201_PARP1_del119/120
Plasmid#240318PurposeEntry vector for Gateway with PARP1 (AA119/120 deletion)DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
Trp1-WT-display
Plasmid#242867PurposeExpression of ECD of WT- Trp1 fused to display TMD.DepositorInsertECD Trp-1-WT fused to display TMD (TYRP1 Human)
UseLentiviralTagsDisplay domainExpressionMammalianAvailable SinceOct. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
SJZ2-TRP1
Plasmid#228256PurposeTemplate plasmid for yeast gene knockout, uses auxotrophic marker TRP1 (Kluyveromyces lactis)DepositorInsertTRP1
ExpressionYeastPromoterBBC1 S.c.Available SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-PARP15
Plasmid#184471PurposeFor gateway cloning of PARP15DepositorInsertPARP15 (PARP15 Human)
UseGateway cloningAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-PARP11
Plasmid#184469PurposeFor gateway cloning of PARP11DepositorInsertPARP11 (PARP11 Human)
Available SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
SFRP1A-c500
Plasmid#205122PurposeSFRP1 protein expressionDepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
SFRP1A-c501
Plasmid#205123PurposeSFRP1 protein expressionDepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LARP1_323-509
Plasmid#209800PurposeBacterial expression of human LARP1 La-moduleDepositorInsertLARP1 La-module (LARP1 Human)
Tags6xHisExpressionBacterialMutationaa 323-509 onlyPromoterT7Available SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
LARP1_323-410
Plasmid#209801PurposeBacterial expression of human LARP1 LaM domainDepositorAvailable SinceNov. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-hARFRP1(WT)-HA
Plasmid#206399PurposeMammalian expression of hARFRP1DepositorAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET16b-Prp16
Plasmid#111351Purposeprotein purificationDepositorInsertPRP16
TagsN-terminally 10xHis-tagged proteins with a Factor…ExpressionBacterialAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
HM110 prp16-2
Plasmid#111277Purposeprp16-2 in pSE358(Trp)DepositorInsertPRP16
ExpressionYeastMutationprp-2 (D575N)Available SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSB58 (Prp16)
Plasmid#111282PurposePrp16 in pSE358(Trp)DepositorInsertPRP16
ExpressionYeastAvailable SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGBKT7-PRP11
Plasmid#87594PurposeEncodes Y2H Gal4 DNA binding domain for Prp11DepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 Rrp1
Plasmid#63773Purposeyeast ORF Rrp1 in the Gateway entry vector pDONR221DepositorInsertRrp1
UseGateway donor vectorAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMV-TRP1
Plasmid#65335Purposestandard plasmids for exogenus pathway assembly haboring yeast auxotrophic marker TRP1 which could be released and ligated to series of TUsDepositorInsertTRP1
UseSynthetic BiologyAvailable SinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only