We narrowed to 3,859 results for: Mak
-
Plasmid#233975PurposeHs TRAV gene for makeTCR assemblyDepositorAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only
-
makeTCR_Hs.TRAV38-2/DV8
Plasmid#233977PurposeHs TRAV gene for makeTCR assemblyDepositorAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
makeTCR_Hs.TRAV29/DV5
Plasmid#233970PurposeHs TRAV gene for makeTCR assemblyDepositorAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
makeTCR_Hs.TRAV14/DV4
Plasmid#233957PurposeHs TRAV gene for makeTCR assemblyDepositorAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 Mak11
Plasmid#63761Purposeyeast ORF Mak11 in the Gateway entry vector pDONR221DepositorInsertMak11
UseGateway donor vectorAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDONR221 Mak16
Plasmid#63762Purposeyeast ORF Mak16 in the Gateway entry vector pDONR221DepositorInsertMak16
UseGateway donor vectorAvailable SinceJuly 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUG-amdSYM-mak10TR
Plasmid#75433PurposeGenerates truncated version of MAK10 gene, which is required for dsRNA L-A propagation in S.cerevisiaeDepositorInsertsMAK10TR
ApR
amdSYM
ExpressionYeastMutationN-terminal 740 bp of MAK10 ORFPromoterNative promoter and PTEFAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CaMaKIIalpha-mKO2
Plasmid#86156PurposeLentiviral fluorescent reporter using the neuronal cell type-specific promoter of the CaM Kinase II alpha gene.DepositorInsertmKO2
UseLentiviralAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAS-mak10 gRNA
Plasmid#160385PurposeExpresses guide RNA for targeting MAK10 in yeastDepositorInsertmak10 gRNA
ExpressionYeastPromoterRNA pol III promoter (tRNA-Tyr)Available SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
MAK gRNA (BRDN0001148291)
Plasmid#76709Purpose3rd generation lentiviral gRNA plasmid targeting human MAKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAK gRNA (BRDN0001146769)
Plasmid#76710Purpose3rd generation lentiviral gRNA plasmid targeting human MAKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAK gRNA (BRDN0001145227)
Plasmid#76711Purpose3rd generation lentiviral gRNA plasmid targeting human MAKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRK5 HA-GST-Presc-mAkt1 (wt)
Plasmid#48805Purposeexpresses wt Akt1DepositorAvailable SinceDec. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTol1-uas-mAKT-2a-nlstdTomato
Plasmid#67706PurposeTol1 expression plasmid with UAS-driven activated Akt-2A-myc tagged nlsTdTomatoDepositorInsertmAKT-2A-nlstdTomato
Available SinceSept. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-NES-SomaKGECO1
Plasmid#232839PurposeAAV transfer plasmid for Syn-mediated expression of soma-targeted KGECO1DepositorInsertNES-SomaKGECO1
UseAAVTagsnuclear export sequenceExpressionMammalianPromoterSynAvailable SinceJuly 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-mAK1-shRNA-1
Plasmid#185364PurposeFor mammalian expression of shRNA: ATCTTGACTCCCTGAAGTAAC that targets mouse AK1 (adenylate kinase)DepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRK5 HA-GST-Presc-mAkt1 (S473T)
Plasmid#48806Purposeexpresses mutant Akt1DepositorAvailable SinceMay 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9(VKMAKG)-P2A-EGFP (RAS3015)
Plasmid#223100PurposepCMV and pT7 Human expression plasmid for SpCas9 enzyme with VKMAKG amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized nuclease SpCas9(VKMAKG)-P2A-EGFP
UseCRISPRTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9(VKMAKG)=D1135V, S1136K, G1218M, E1219A, R1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
-