We narrowed to 8,785 results for: Ott
-
Plasmid#50834PurposeAn AAV packaging vector that expresses channel rhodopsin 2 (H134R) (fused to EYFP) under the EF1a promoter, which can be deactivated (deleted) by recombination between the flanking loxP sites.DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1179 - pAAV (flox-stop) TH gRNA A EF1a eGFP
Plasmid#113158PurposeAn AAV vector that expresses a Cre-dependent guide RNA targeting rat TH and expresses EGFP reporterDepositorInsertgRNA for rat TH
UseAAV, CRISPR, and Cre/LoxExpressionMammalianPromotermU6Available SinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1784 - pAAV SYN1 hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201820PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1619 pAAV SYN1 Nuc-EYFP miR-30 SST
Plasmid#135565PurposeAn AAV vector expressing miR-30a shRNA vs rat SOM (aka SST) and a nuclear EYFP reporterDepositorInsertsmiR-30 rat SST
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianPromoterSYN1 and hSYN1Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1618 pAAV SYN1 Nuc-EYFP miR-30 FF3
Plasmid#135564PurposeAn AAV vector expressing miR-30a shRNA vs FF luciferase and a nuclear EYFP reporterDepositorInsertsmiR-30 FF3
Nuc-EYFP
UseAAVTags3xNLSExpressionMammalianPromoterSYN1 and hSYN1Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1845 - pAAV CaMKII hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201822PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a CaMKii promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterCaMKiiAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1584 - pscAAV CMV-IE secreted EGFP-THPKTEL WPRE
Plasmid#188539PurposeAn AAV packaging vector that expresses secreted C-CDNF under control of the EGFP promoter.DepositorInsertsecreted EGFP
UseAAVTagsCDNF(1-28) and THPKTEL WPREPromoterCMV-IEAvailable SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH270-Tier1-OTtgO2-PCMVmin2-SEAP-p2A-iRFP670
Plasmid#169592PurposeTier-1 vector encoding PTtgO2-driven SEAP-p2A-iRFP670 expression (OTtgO2-PCMVmin-2-SEAP-p2A-iRFP670-pA).DepositorInsertphloretin-controlled SEAP and iRFP expression
ExpressionMammalianPromoterTtgO2-PCMVmin-2Available SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
Plasmid#131683PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1534 pscAAV mU6 shRNA(PKCd) CMV-IE Nuc-EYFP
Plasmid#135562PurposeAn AAV vector expressing shRNA vs rat PKCd and a nuclear EYFP reporterDepositorInsertsshRNA (mouse PKCd)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1822 - pAAV SYN1 DIO hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201821PurposeAn adeno-associated viral vector expressing Cre-dependent channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PETDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1535 pscAAV mU6 shRNA(scram) CMV-IE Nuc-EYFP
Plasmid#135563PurposeAn AAV vector expressing scrambled shRNA and a nuclear EYFP reporterDepositorInsertsshRNA (scrambled)
Nuc-EYFP
UseAAV and RNAiTags3xNLSExpressionMammalianPromoterCMV-IE and mU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1789 - pAAV (flox-stop) mGrid1 390F gRNA A EF1a eGFP-KASH
Plasmid#131684PurposeAn adeno-associated viral vector expressing nuclear envelope-embedded eGFP and a Cre-dependent guide RNA for mGrid1DepositorInsertsEGFP-KASH
SpCas9 sgRNA vs mouse GRID1
UseAAVTagsKASHPromoterEF1a and mU6-LSL (Cre dependent)Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC810 - pAAV-EF1a-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL
Plasmid#63885PurposeAn AAV packaging vector that expresses ER-retained low-affinity GCaMP3 variant under control of the EF1a promoter.DepositorInsertER-localized low-affinity GCaMP3(10.19)
UseAAVPromoterEF1aAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC814 - pAAV-SYN1-CRTsigpep-GCaMP3 (D324G+D360G+397G+D435G 10.19)-KDEL
Plasmid#63887PurposeAn AAV packaging vector that expresses ER-retained low-affinity GCaMP3 variant under control of the SYN1 promoter.DepositorInsertER-localized low-affinity GCaMP3(10.19)
UseAAVPromoterhuman SYN1Available SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
XE51 XPKC-alpha
Plasmid#16746DepositorInsertXPKC-Alpha (prkca Frog)
UseXenopus expressionAvailable SinceApril 7, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRH030
Plasmid#159633PurposeCRISPR‐Cas9 tool for the genetic engineering of Bacillus phagesDepositorTypeEmpty backboneUseCRISPR; Shuttle vectorPromoterConstitutive tracrRNAAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -