We narrowed to 1,885 results for: BRE
-
Plasmid#78917PurposeMammalian expression of BAP1 with H169Q and an EGFP fusionDepositorAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pEGFP-WRAP53beta-DC-mutant-G435R
Plasmid#64684Purposeexpresses single mutated WRAP53beta at G435R, found in Dyskeratosis congenita patientsDepositorInsertWD40-encoding RNA antisense to P53 (WRAP53 Human)
TagsGFPExpressionMammalianMutationmutation at G435RPromoterCMVAvailable sinceMay 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-WRAP53beta-DC-mutant-R398W
Plasmid#64683Purposeexpresses single mutated WRAP53beta at R398W, found in Dyskeratosis congenita patientsDepositorInsertWD40-encoding RNA antisense to P53 (WRAP53 Human)
TagsGFPExpressionMammalianMutationmutation at R398WPromoterCMVAvailable sinceMay 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT S6K (E389-deltaCT)
Plasmid#58507PurposeGateway entry vector for an inducible HA-tagged rat S6K1-E389-deltaCTDepositorInsertRps6kb1 (Rps6kb1 Rat)
UseGateway CloningTagsHAMutationT389E, stop codon at amino acid 402Available sinceAug. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC19mut_circIRES4_FLuc_3HA
Plasmid#249687PurposeThis plasmid is designed to evaluate the translation efficiency of IRES4, an internal ribosome entry site derived from the Pelargonium flower break virus.DepositorInsertIRES of Pelargonium flower break virus
UseSynthetic BiologyTags3xHAExpressionBacterialPromoterT7 PromoterAvailable sinceJuly 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
pHAGE Flag HA MPG
Plasmid#237804PurposeLentiviral vector expressing WT MPGDepositorAvailable sinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-WWE-Linker-eGFP
Plasmid#176072PurposeEGFP fused to the C-terminus of a WWE domain & a hygromycin resistance cassetteDepositorInsertWWE
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pEGFP-WRAP53beta-WD40domain
Plasmid#64678PurposeExpresses the WD40 domain of WRAP53betaDepositorInsertWd40-encoding RNA antisense to P53 (WRAP53 Human)
TagsGFPExpressionMammalianMutationcontaining only WD40 domain of WRAP53betaPromoterCMVAvailable sinceMay 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCaSpeR-hs-taiman
Plasmid#17585DepositorPublicationInserttaiman (tai Fly)
ExpressionInsectAvailable sinceNov. 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
LVIS_1595
Plasmid#255508PurposeDERA enzyme production under control of T7 promoter and inducible lac operatorDepositorInsert2-deoxyribose-5-phosphate aldolase (DERA) from Lactobacillus brevis
Tags6xHis tag-TEV protease recognition site (ENLYFQ/G…ExpressionBacterialMutationWTPromoterT7Available sinceMay 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
GST-GRP78-Full Length (pGEX4T1)
Plasmid#238421PurposeExpresses GRP78 Full Length fused to the GST TagDepositorAvailable sinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
SOX2-P2A-tagBFP-HDR
Plasmid#163751PurposeHDR knock-in template for tagging the human endogenous SOX2 gene with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.DepositorInsertSOX2 (SOX2 Human)
UseCRISPR and Synthetic BiologyTagsP2A-tagBFPMutationDoes not contain start codon to avoid random inte…Available sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pRK-FLAG-TRAF4(K190R)
Plasmid#58317PurposeFLAG-tagged mouse TRAF4 K190R mutantDepositorInsertTNF receptor associated factor 4 (Traf4 Mouse)
TagsFLAGExpressionMammalianMutationK 190 to RPromoterCMVAvailable sinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 DOX off blast POLD1
Plasmid#241438PurposeExpresses DOX-suppressible POLD1DepositorAvailable sinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV-FLAG-TAOK2
Plasmid#197862PurposeExpression of FLAG-tagged TAOK2 / PSK1 alpha in mammalian cellsDepositorAvailable sinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-FKBP-TPD54(L53P,L67P)
Plasmid#172458PurposeExpression of Tumor Protein D52 like 2 (TPD54/TPD52L2) with N-terminal mCherry-FKBP tag L53P,L67P mutantDepositorInsertTPD54 (TPD52L2 Human)
TagsmCherry-FKBPExpressionMammalianMutationchanged Leucines 53 and 67 to proline (breaks coi…PromoterCMVAvailable sinceAug. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-DDX11-Flag-KAE
Plasmid#120728PurposeExpression of a Flag-tagged version of DDX11 KAE mutant in mammalian cellsDepositorInsertDDX11 KAE mutant (DDX11 Human)
Tags3x FLAGExpressionMammalianMutationSubstitution of E201 and Y202 with K and APromoterCMVAvailable sinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only