We narrowed to 81,735 results for: TRI

#131785

AAV donor/transfer vector expressing CreLite system components, PhyBΔCreC and PIF6CreN, driven by CBh promoter

George Eisenhoffer

Yen et al Dev Dyn. 2020 Nov;249(11):1394-1403. doi

Jan. 9, 2020

Academic Institutions and Nonprofits only

#80060

Myl7 promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequences

Tatjana Sauka-Spengler

Trinh et al Cell Rep. 2017 Apr 11;19(2):425-440. doi

Oct. 11, 2016

Academic Institutions and Nonprofits only

#191755

Expression of N-terminally mGFP labelled mutated FGFR3 (isoform IIIc)-G380R mutation (associated with ACH; target mutation: c.1138G>A; silent mutation added on purpose: c.1131C>T)

Irene Tiemann-Boege

Hartl et al J Biol Chem. 2023 Feb;299(2):102832. doi

Jan. 19, 2023

Academic Institutions and Nonprofits only

#112761

express GFP-4EBP1-Rheb15

Roberto Zoncu

Lawrence et al Nat Cell Biol. 2018 Sep;20(9):1052-1063.

Nov. 26, 2018

Academic Institutions and Nonprofits only

#85209

TRCN0000116119 (Target CGACGAAAGGCATGTACCATA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.

Sandra Martha Gomes Dias

Quintero et al BMC Cancer. 2017 Nov 7;17(1):727. doi: 1

Oct. 4, 2017

Academic Institutions and Nonprofits only

#123339

Yellow-fluorescent homoFRET/anisotropy-based biosensor for monitoring ERK activity. Contains monomeric Venus/cpVenus-E172 homoFRET pair.

Jin Zhang

Ross et al eLife. 2018 Jul 3;7. pii: 35458. doi: 10

July 28, 2020

Academic Institutions and Nonprofits only

#90499

pSIN - EF-1alpha - PIF3 - MTAD - IRES - PhyB - GBD, dual vector of PIF3-MTAD under EF-1 alpha promoter and PhyB-DBD under IRES promoter; See growth conditions below.

Todd Coleman

Kyriakakis et al ACS Synth Biol. 2018 Feb 16;7(2):706-717

June 8, 2018

Academic Institutions and Nonprofits only