We narrowed to 1,634 results for: CAG promoter
-
Plasmid#193667PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA1
Plasmid#160945PurposeGuide RNA 1 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
-161+80pCalb2/dmutNRF-1(-41;-35)-like
Plasmid#66741Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationCGCAGGCGC (-41;-35) to ATTAGGATTPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro
Plasmid#208398Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, E2-Crimson fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsE2-CrimsonExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
Plasmid#208400Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, mNeonGreen fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsmNeonGreenExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-PrPro
Plasmid#227453Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-PrPro
Plasmid#227454Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hIL2RN gRNA_multi1-3-MS2-Puro
Plasmid#192684PurposeLentiviral expression of multi gRNAs targeting hIL1RN promoter to activate human IL1RN transcriptionDepositorInsertHuman IL1RN activating gRNAs #1,2,3 (IL1RN Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v2)-PGK-Puro-BFP
Plasmid#117141PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v2 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC1802_pmax-RBFOX1N-dCasRx-C
Plasmid#118635PurposeTransient transfection; Expresses RBFOX1N-dCasRx-C; CAGGS promoterDepositorInsertRBFOX1N-dCasRx-C
UseCRISPRExpressionMammalianPromoterCAGGSAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
p3E-U6a-U6c-opa1 guide
Plasmid#121995PurposeAn entry vector with U6a and U6c promoter driving opa1 guide RNAs expressionDepositorInsertopa1 gRNA
UseCRISPRAvailable SinceSept. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC29
Plasmid#104803PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr4g094545 (Hen1). Also expresses Cas9 from Gmubi promoter.DepositorInsertMedtr4g094545
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
1197TCC_gZBF-HG
Plasmid#241826PurposepgSIT 2.0 gRNA expressing plasmid with working HR5Ie1-EGFP SEPARATOR cassetteDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPN283
Plasmid#91666PurposeExpress sgRNA targeting human SDCCAG8DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only