We narrowed to 6,812 results for: KIT;

#87402

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#178730

AAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GCaMP6f in neurons under the control of the hSyn1 promoter (Kugler et al 2003)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#87403

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87399

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#178717

AAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of dTom in cortical interneurons under the control of the Dlx enhancer (Dimidschstein et al 2016)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#178719

AAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-OFF) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#178720

AAV vector for Cre- and Flp-dependent transgene expression (CRE-OFF / FLP-ON) of dTom in neurons under the control of the hSyn1 promoter (Kugler et al 2003)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#178712

AAV vector for Cre- and Flp-dependent transgene expression (CRE-ON / FLP-ON) of GFP in neurons under the control of the hSyn1 promoter (Kugler et al 2003)

Jordane Dimidschstein

Pouchelon et al Cell Rep Methods. 2022 May 26;2(6):10022

May 26, 2022

Academic Institutions and Nonprofits only

#87394

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#165492

Neuronal expression of PACmn with dark Venus, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activity

Thomas Oertner

Yang et al BMC Biol. 2021 Oct 18;19(1):227. doi: 10

Oct. 21, 2021

Academic Institutions and Nonprofits only