We narrowed to 9,513 results for: control
-
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTol2-rtn1a-KALTA4
Plasmid#239989PurposeExpresses GAL4 under control of the rtn1a promoterDepositorInsertsKALTA4
EGFP
UseZebrafish tol2/phic31 compatiblePromotermyl7 and rtn1aAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-atp6v0cb-KALTA4
Plasmid#239985PurposeExpresses GAL4 under control of the atp6v0cb promoterDepositorInsertsKALTA4
EGFP
UseZebrafish tol2/phic31 compatiblePromoteratp6v0cb and myl7Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM3D(Gq)-mCherry
Plasmid#50476PurposeGq-coupled hM3D DREADD fused with mCherry under the control of CaMKIIa promoterDepositorHas ServiceAAV1, AAV2, AAV5, AAV8, and AAV9InserthM3D(Gq)-mCherry (CHRM3 Human)
UseAAVTagsmCherryMutationSee supplemental documents for DREADD mutationsPromoterCaMKIIaAvailable SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJYDN2p
Plasmid#162455PurposePositive control plasmid for co-cultivation labeling by using designed ALFA-tag binding nanobody (DnbALFA).DepositorInsertAga2p-DnbALFA (AGA2 )
UseShuttle vector bacteria/yeastTagsDnbALFA nanobody and HA and mycPromoterGAL1Available SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hM4D(Gi)-mCherry
Plasmid#50477PurposeGi-coupled hM4D DREADD fused with mCherry under the control of CaMKIIa promoterDepositorHas ServiceAAV1, AAV2, AAV5, AAV8, and AAV9InserthM4D(Gi)-mCherry (CHRM4 Human)
UseAAVTagsmCherryMutationSee supplemental documents for DREADD mutationsPromoterCaMKIIaAvailable SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-HA-hM3D(Gq)-IRES-mCitrine
Plasmid#50463PurposeGq-coupled hM3D-IRES-mCitrine under the control of human synapsin promoterDepositorInserthM3D(Gq)-IRES-mCitrine (CHRM3 Human)
UseAAVTagsHAMutationSee supplemental documents for DREADD mutationsPromoterhuman Synapsin 1Available SinceApril 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pKB225
Plasmid#170015PurposeEncodes LacI-controlled expression of surface display protein with no C-terminal peptide and PvirK-mNeonGreen reporterDepositorArticleInsertsmNeonGreen
Peptide display protein with no C-terminal peptide
UseSynthetic BiologyTagsLpp, OmpA, and TetherExpressionBacterialPromoterPtac and PvirKAvailable SinceNov. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJLG038
Plasmid#192981PurposeBHR plasmid (pBBR1 ori) expressing T7 polymerase under control of the lac promoterDepositorInsertT7 polymerase
ExpressionBacterialPromoterlacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
poRBS
Plasmid#154125PurposeExpresses orthogonal rRNAs operon in bacterial cellsDepositorInsertengineered bacterial rRNAs operon under control of pL promotor
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 2, 2020AvailabilityAcademic Institutions and Nonprofits only