We narrowed to 875 results for: seph
-
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMTP140 (pBAD322G_TniQ-Cascade(Tn6900))
Plasmid#164262PurposeVector expressing the TniQ, Cas8/5, Cas7, and Cas6 proteins from the Tn6900 element with an arabinose promoter.DepositorInsertCodon-optimized tniQ-cas8/5-cas7-cas6 operon from Tn6900 from A. salmonicida S44 pS44-1
UseTagsExpressionBacterialMutationPromoterAvailable sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
NG0886 pCI-TPI-WT-4H
Plasmid#65801PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
UseTags4H (4 copies of short beta-globin 3'UTR for …ExpressionMammalianMutationPromoterCMVAvailable sinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-ASPM MTB
Plasmid#27668DepositorInsertAbnormal spindle-like microcephaly associated (Aspm Rat)
UseTagsGFPExpressionMammalianMutationContains amino‑terminal putative microtubule bind…PromoterAvailable sinceApril 1, 2011AvailabilityAcademic Institutions and Nonprofits only -
ClCry4 Y319D
Plasmid#160649PurposeExpression of protein for various experiments including finding interaction partnersDepositorInsertClcry4 PHR Y319D
UseTagsHexa hisExpressionBacterialMutationPromoterAvailable sinceOct. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGL2
Plasmid#48742PurposeExpression of luciferase driven by truncated mPer2 promoter region (bases -1128 to +386 with respect to transcription start site at +1)DepositorInserttruncated mPer2 promoter/enhancer region (-1128 to +386)
UseLuciferaseTagsExpressionMutationtruncated promoter region (see pGL6)PromoterAvailable sinceDec. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMTP130 (pTA106_TnsABC(Tn6900))
Plasmid#164261PurposeVector expressing the TnsA, TnsB, and TnsC transposition proteins from the Tn6900 derivative element with a lactose promoter.DepositorInserttnsA, tnsB, and tnsC from Tn6900 derivative from A. salmonicida S44 pS44-1
UseTagsExpressionBacterialMutation(tnsA) Changed Alanine 125 to Aspartic acidPromoterLactoseAvailable sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4
Plasmid#48744PurposeExpression of luciferase driven by truncated mPer2 promoter region (bases -1128 to +1536 with respect to transcription start site at +1)DepositorInserttruncated mPer2 promoter/enhancer region (-1128 to +1536)
UseLuciferaseTagsExpressionMutationtruncated promoter region (see pGL6)PromoterAvailable sinceJan. 31, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-myc-ASPM CTR
Plasmid#27669DepositorInsertAbnormal spindle-like microcephaly associated (Aspm Rat)
UseTagsGFPExpressionMammalianMutationContains carboxy terminal region of ASPM (amino a…PromoterAvailable sinceMarch 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pfastbac/mBmal62-447
Plasmid#47335PurposemBmal fragment cloned into pfastbac and crystallizedDepositorInsertBMAL (Bmal1 Mouse)
UseTagsExpressionMutationaa 62-447PromoterAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only