We narrowed to 4,630 results for: pcr
-
Plasmid#41461DepositorInsert3AC4
UsePcr cloning vectorAvailable SinceJan. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
TAL-3GA4
Plasmid#41468DepositorInsert3GA4
UsePcr cloning vectorAvailable SinceJan. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-birA*
Plasmid#179788PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertbirA
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTR
Plasmid#63143PurposePCR template to construct polycistronic tRNA-gRNADepositorInsertgRNA-tRNA fusion
UseCRISPR and Synthetic BiologyAvailable SinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
L0-I32 pLBD16 GG0-GG1
Plasmid#195903PurposeLevel 0 pLBD16 promoter with GG0 and GG1 golden gate linkersDepositorInsertpLBD16
UseSynthetic BiologyAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-HaloTag
Plasmid#181953PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertHaloTag
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pADH110
Plasmid#90982PurposeNAT-marked pSNR52 promoter fragment for use in gRNA expression cassette stitching PCR; for use with pADH119, 139, or 147 to generate target-specific gRNA expression cassette.DepositorInsertsNAT 2 of 2
pSNR52
UseCRISPRAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-TurboID-3MYC-kanMX6 (pFB1420)
Plasmid#126049PurposeFor C-terminal tagging with TurboID in yeast including geneticin-resistant markerDepositorInsertTurboID
UsePcr-based c-terminal taggingAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-TurboID-3MYC-natMX6 (pFB1434)
Plasmid#126050PurposeFor C-terminal tagging with TurboID in yeast including nourseothricin-resistant markerDepositorInsertTurboID
UsePcr-based c-terminal taggingAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJJS012
Plasmid#188335PurposePCR template for repair templates to tag a gene with a mTagBFP2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mTagBFP2::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS011
Plasmid#188334PurposePCR template for repair templates to tag a gene with a mTagBFP2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mTagBFP2::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-10Myc
Plasmid#181939PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert10xMyc
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-g418-3HA
Plasmid#247593PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert3xHA
UseUnspecifiedPromoterread throughAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
L0-I9 PhiC31 GG1-GG4
Plasmid#195892PurposeLevel 0 PhiC31 integrase with GG1 and GG4 golden gate linkersDepositorInsertPhiC31 integrase
UseSynthetic BiologyAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJJS006
Plasmid#188329PurposePCR template for repair templates to tag a gene with a mNeonGreen and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mNeonGreen::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-FKBP-GFP-HIS3MX6
Plasmid#183023PurposePCR-based tagging of yeastDepositorInsertFKBP
UseYeast genomic targetingAvailable SinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-eGFP-MCS-polyA
Plasmid#174024PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInserteGFP
UseZebrafish knock-in taggingAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-eGFP_Y40N-MCS-polyA
Plasmid#174025PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInserteGFP
UseZebrafish knock-in taggingMutationY40NAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-blast-His:mNG:His
Plasmid#201094PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only