We narrowed to 27,024 results for: CAT
-
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-PM BRD7 sh3
Plasmid#41930DepositorAvailable SinceMay 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
CtkA_full_cmv-10
Plasmid#27433DepositorAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
CtkA_D155Q/D179Q_cmv-10
Plasmid#27435DepositorInsertCell translocating kinas A (jhp0940 H. pylori)
Tags3xFLAGExpressionMammalianMutationD155Q/D179QAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
CtkA_full_pET21a
Plasmid#27428DepositorAvailable SinceMay 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
CtkA_D155Q_pET21a
Plasmid#27430DepositorAvailable SinceMay 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
CtkA_D179Q_pET21a
Plasmid#27431DepositorAvailable SinceMay 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
CtkA_D155Q/D179Q_pET21a
Plasmid#27432DepositorInsertCell translocating kinas A (jhp0940 H. pylori)
TagsHisExpressionBacterialMutationD155Q/D179QAvailable SinceMay 2, 2011AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd7 gRNA
Plasmid#246566PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd7 gRNADepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD1112 TRE-NLS-mMaroon1-NLS-22Xm6A MS2
Plasmid#235129PurposemMaroon1 reporter plasmid for live cell visualization of RNA m6A modificationDepositorInsertTRE-NLS-mMaroon1-NLS-22Xm6A MS2
UseLentiviralExpressionMammalianAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD1112 TRE-mCherry-SKL-22Xm6A MS2
Plasmid#235128PurposemCherry reporter plasmid for live cell visualization of RNA m6A modificationDepositorInsertTRE-mCherry-SKL-22Xm6A MS2
UseLentiviralExpressionMammalianAvailable SinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a asyn(66-140) E83A
Plasmid#240583PurposeOverexpress truncated alpha-Synuclein proteinDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a asyn(66-140) K80A
Plasmid#240584PurposeOverexpress truncated alpha-Synuclein proteinDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a asyn(66-140) K96A
Plasmid#240585PurposeOverexpress truncated alpha-Synuclein proteinDepositorAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a asyn(66-140) K97A
Plasmid#240586PurposeOverexpress truncated alpha-Synuclein proteinDepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a asyn(66-140) K102A
Plasmid#240588PurposeOverexpress truncated alpha-Synuclein proteinDepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET21a asyn(66-140) D98A
Plasmid#240587PurposeOverexpress truncated alpha-Synuclein proteinDepositorAvailable SinceAug. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 Neo-MORC3_gRNA_1
Plasmid#235529PurposegRNA against human MORC3DepositorInsertMORC3 (MORC3 Human)
UseLentiviralAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPMEL-Nluc-hbb
Plasmid#239862PurposeTemplate for in vitro transcription of secreted nanoluciferase, with signal peptide from PMEL, flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertSecreted nanoluciferase, with signal peptide from PMEL (gp100), flanked by human haemoglobin beta 5' and 3' UTRs
UseLuciferasePromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDF_AaRaf1/Raf2/BSD2
Plasmid#229515PurposeExpresses Anthoceros agrestis chaperones: Raf1,Raf2,BSD2DepositorInsertsRubisco accumulation factor 1
Rubisco accumulation factor 2
BSD2
ExpressionBacterialMutationN terminus chloroplast transit peptide truncationPromoterT7Available SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-3xGFP11-mem-3xPax7gRNA
Plasmid#224571PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE:mTRAAK
Plasmid#224765PurposeIn vitro transcription for Oocyte expression of mTRAAKDepositorInsertPotassium channel subfamily member 4 (Kcnk4 Mouse)
UseIn vitro transcription for oocyte expressionPromoterT7Available SinceSept. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
USP7 shRNA-TRE
Plasmid#225338PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertUSP7 shRNA (Usp7 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp21R
Plasmid#218287PurposeA complete plasmid for ToxAmp (Toxin-antitoxin-driven gene amplification) for the expression of AeBlueDepositorInsertHO(-955, -789)-LoxP>pKlLEU2>KlLEU2>PCRT1>RelB>tPDC1-pTDH3>AeBlue>tSYNth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp12
Plasmid#218286PurposeMulti-copy integration of heterologous genes (AeBlue and RelB) through co-transformation with ToxAmp (toxin-antitoxin-driven gene amplification) modulesDepositorInsertHO(-253, -1)-pCRT1>RelB>tPDC1-pTDH3>AeBlue>tsynth7-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pToxAmp1
Plasmid#218285PurposeAmplifying the gene copy number of heterologous genes (yEGFP and RelB) through ToxAmp (toxin-antitoxin-driven gene amplification) mechanismDepositorInsertHO(-253, -1)-pRPL8B>RelB>tPDC1-pTEF1>yEGFP>tURA3-ARS712-HO(-731, -264)
ExpressionYeastAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
p11d-RPA70/14 (MSW#134)
Plasmid#208076PurposeExpression of human Replication Protein A 70 and 14-kDa subunits in E. coli with 14 having a His-tagDepositorAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL0_AC-27877
Plasmid#202110PurposeLevel 0 plasmid containing the promoter from gene 27877 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert27877 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_CE-OriT
Plasmid#202150PurposeLevel 0 plasmid containing an origin of transfer sequence from pPtPBR11 required for making plasmids mobilizable for conjugation with CE overhangs used to build level 1 constructs.DepositorInsertOrigin of transfer
UseSynthetic BiologyMutationOriT sequence mutated to remove sapI sites domest…Available SinceAug. 25, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-Fld
Plasmid#202125PurposeLevel 0 plasmid containing the promoter from gene 23658 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertFld promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-54730
Plasmid#202109PurposeLevel 0 plasmid containing the promoter from gene 54730 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert54730 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-51183
Plasmid#202108PurposeLevel 0 plasmid containing the promoter from gene 51183 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert51183 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-GEF
Plasmid#202107PurposeLevel 0 plasmid containing the promoter from gene 41365 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertGEF promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-47740
Plasmid#202106PurposeLevel 0 plasmid containing the promoter from gene 47740 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsert47740 promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI site for…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-BCA
Plasmid#202105PurposeLevel 0 plasmid containing the promoter from gene 51305 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertBCA promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove sapI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-epyC
Plasmid#202104PurposeLevel 0 plasmid containing the promoter from gene 41316 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertepyC promoter
UseSynthetic BiologyMutationPromoter sequence mutated to remove bsaI sites fo…Available SinceAug. 23, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV_tKiMBImut-T2A-caMEK
Plasmid#199579PurposeExpress tKiMBImut(AA) and caMEK in an AAV vectorDepositorInsertsERK tdTomato-Kinase-Modulated Bioluminescent Indicator (mutant)
constitutively active MEK
UseAAVExpressionMammalianPromoterCMVAvailable SinceJune 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRA1SEGFPTcIfm
Plasmid#193777PurposeCassette 1: Expresses EGFP under the control of PR promoter, Cassette 2: Expresses frame-shifted CI under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertEGFP and frame-shifted CI in opposite orientation, controlled by separate promoters and terminators
UseSynthetic BiologyExpressionBacterialPromoterPR promoter and PLTetO-1Available SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only