We narrowed to 4,921 results for: puc
-
Plasmid#183759PurposeBxb1-specific donor plasmid for intergrating a transcription unit for expression of membrane-localised miRFP703DepositorInsertmiRFP703
UseTagsLck lipidation signalExpressionMammalianMutationPromoterAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-dsRed-shvgat
Plasmid#71385PurposeExpresses dsRed and shRNA against vgat under the control of the CMV promoter in eukaryotic cellsDepositorInsertCMV promoter-dsRed-mir30-shvgat
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterCMV enhancer/promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTn7CdrA-gfpC
Plasmid#111616PurposeFluorescence-based gauging of the level of the nucleotide secondary messenger cyclic di-GMP in Pseudomonas aeruginosa and related species.DepositorInsertPcdrA-RBSII-gfp(Mut3)-T0-T1
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
Bxb1-ASAP2f
Plasmid#183757PurposeBxb1-specific donor plasmid for intergrating a transcription unit for expression of ASAP2f voltage reporterDepositorInsertASAP2f
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-iCre-2A-venus
Plasmid#182499PurposeExpresses iCre-venus. The promoter is a fragment of the hdc gene promoter that gives pan neuronal expressionDepositorInsertiCre-2A-Venus
UseAAV and Cre/LoxTagsExpressionMammalianMutationPromoterfragment of histidine decarboxylase gene promoter…Available sinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Bxb1_jRCaMP1b
Plasmid#183758PurposeBxb1-specific donor plasmid for intergrating a transcription unit for expression of jRCaMP1b calcium reporterDepositorInsertjRCaMP1b
UseTagsNESExpressionMammalianMutationPromoterAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAd388-shLuc
Plasmid#83275PurposeshRNA targeting luciferaceDepositorInsertshRNA to Luciferase
UseRetroviralTagsExpressionMutationPromoterpUC oriAvailable sinceDec. 2, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTA1cI-T3
Plasmid#193789PurposeExpresses truncated version of lambda CI named T3 under the control of PLTetO-1 promoter, pUC origin of replication, Ampicillin selectionDepositorInsertTruncated version of Lambda CI, named T3, where the first two codons are deleted
UseSynthetic BiologyTagsExpressionBacterialMutationPromoterPLTetO-1Available sinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
KG#797
Plasmid#110916PurposeExpresses the active zone - enriched protein Sentryn-GFP in a subset of cholinergic ventral nerve cord motor neuronsDepositorInsertsunc-129 promoter
STRN-1 (Sentryn)-GFP
unc-54 3' control region with 1 intron just upstream and 1 intron in control region
UseTagsGFP (contains 3 artificial introns)ExpressionBacterialMutationPromoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#920
Plasmid#110937PurposeExpresses INS-22-Emerald in the cholinergic motor neuron DA9 for imaging Dense Core Vesicles in a single neuron in a living animalDepositorInsertsmig-13 promoter
INS-22-Emerald
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-P15L-_lox
Plasmid#129756PurposeGene targeting in marmoset cellsDepositorInsertPLP1 (PLP1 C. jacchus (common marmost))
UseMarmoset targetingTagsExpressionMutationP15LPromoterAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-A39T
Plasmid#129752PurposeGene targeting in marmoset cellsDepositorInsertPLP1 (PLP1 C. jacchus (common marmost))
UseMarmoset targetingTagsExpressionMutationA39TPromoterAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKI-cjPLP1e2-P15L
Plasmid#129753PurposeGene targeting in marmoset cellsDepositorInsertPLP1 (PLP1 C. jacchus (common marmost))
UseMarmoset targetingTagsExpressionMutationP15LPromoterAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KG#493
Plasmid#110932PurposeExpresses proteins in C. elegans cholinergic neurons in head, ventral nerve cord, and tailDepositorInsertsunc-17 promoter
unc-54 3' control region
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#94
Plasmid#110931PurposeExpresses proteins in C. elegans cholinergic neurons in head, ventral nerve cord, and tailDepositorInsertsunc-17 promoter
unc-54 3' control region
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS1932
Plasmid#79781PurposeHigh copy number pUC vector containing Ple259 (PAX6 MiniPromoter) insertDepositorInsertPle259
UsePleiades promoter project [sic, pleaides plieades]TagsExpressionMutationPromoterPle259 (PAX6 MiniPromoter)Available sinceSept. 14, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1937
Plasmid#79782PurposeHigh copy number pUC vector containing Ple260 (PAX6 MiniPromoter) insertDepositorInsertPle260
UsePleiades promoter project [sic, pleaides plieades]TagsExpressionMutationPromoterPle260 (PAX6 MiniPromoter)Available sinceSept. 14, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
AAVS1-Bxb1-LP-TC
Plasmid#183754PurposeAAVS1 targeting construct with the Bxb1 landing pad cassette.DepositorInsertloxP-eGFP-attP-Bsd-lox257
UseCre/Lox and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-phiC31-LP-TC
Plasmid#183755PurposeAAVS1 targeting construct with the phiC31 landing pad cassette.DepositorInsertFRT-mCherry-attP-BleoR-F3
UseSynthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only