We narrowed to 369 results for: TP53
-
Plasmid#136520PurposeUsed as a donor vector containing N-term 3xFLAG to clone into pSLIKDepositorInsertp53DD (Trp53 Mouse)
UseGateway CloningTags3x FLAGMutationThis construct was created by PCR from the pBabe …Available SinceOct. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344P-mKate2-splitmVenusN
Plasmid#69586PurposeExpresses mutated p53-L344P tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344P (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344P mutation that prevents dimerization and…PromoterEF1alphaAvailable SinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
(203-bp-DIAL-YB_TATA)-Halo-p53-BGH_pKG2745
Plasmid#246339Purpose203-bp DIAL Reporter Plasmid with YB_TATA expressing Halo-p53 in the presence of ZFa and editable by Cre recombinaseDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBneo-CIBN-lin-p53CT(98-393)-R273H-mNeonGreen-NLSx3
Plasmid#241849PurposeExpresses a negative control of the localizer of Opto-p53 in mammalian cells.DepositorInsertp53 (TP53 Human)
TagsCIBN and mNeonGreenExpressionMammalianMutationp53 C-terminus (97-393 aa) containing R273H mutat…PromoterCAGGS promoterAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-NLSx3-miRFP703-dSal-p53NT(1-97)-L22Q/W23S/W53Q/F54S-lin-hCRY2
Plasmid#241847PurposeExpresses a negative control of the actuator of Opto-p53 in mammalian cells.DepositorInsertp53 (TP53 Human)
TagsCRY2 and miRFP703ExpressionMammalianMutationN-terminus (1-97 aa) containing L22Q/W23S/W53Q/F5…PromoterCAGGS promoterAvailable SinceSept. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLOC-D133p53a
Plasmid#241916PurposeLentiviral vector driving a p53 isoform delta133p53alpha. Stable expression in cultured human cells and possibly cells of other species.DepositorAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28-p53 (1-73) (K24N)
Plasmid#62079PurposeExpression of human p53 (1-73) (K24N) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationcontains TAD residues 1-73; K24NPromoterT7Available SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRRLNeo-pEF1a-p53ashL344A-mKate2-splitmVenusN
Plasmid#69584PurposeExpresses mutated p53-L344A tagged with mKate2 and split N-term mVenusDepositorInsertp53-L344A (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - N termExpressionMammalianMutationp53 L344A mutation that prevents tetramerization …PromoterEF1alphaAvailabilityAcademic Institutions and Nonprofits only -
pRRLHygro-pEF1a-p53ashL344A-mKate2-splitmVenusC
Plasmid#69585PurposeExpresses mutated p53-L344A tagged with mKate2 and split C-term mVenusDepositorInsertp53-L344A (TP53 Human)
UseLentiviralTagsmKate2 and split mVenus - C termExpressionMammalianMutationp53 L344A mutation that prevents tetramerization …PromoterEF1alphaAvailabilityAcademic Institutions and Nonprofits only -
shp63alpha pLKO.1 puro
Plasmid#19120DepositorInsertsmall hairpin RNA against tumor protein p63 (TP63 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
shp53 pLKO.1 puro
Plasmid#19119Purpose3rd gen lentiviral vector for knocking down p53 gene expressionDepositorInsertsmall hairpin RNA against tumor protein p53 (TP53 Human)
UseLentiviral and RNAiExpressionMammalianAvailable SinceSept. 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
Px461-Cas9n-Trp53-sgRNA-alpha
Plasmid#88846PurposeCRISPR KO of Trp53DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px461-Cas9n-Trp53-sgRNA-beta
Plasmid#88847PurposeCRISPR KO of Trp53DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSicoR p53
Plasmid#12090PurposeCre-regulated lentiviral shRNA vector. Cre addition causes both EGFP and shRNA to be recombined out of the construct, turning OFF p53 shRNA expression.DepositorInsertp53 shRNA (Trp53 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSico p53
Plasmid#12089PurposeCre-regulated lentiviral shRNA vector. Cre addition causes EGFP to be recombined out of the construct, activating p53 shRNA expression.DepositorInsertp53 shRNA (Trp53 Mouse)
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianMutationEGFP is expressed from this plasmid as a marker, …Available SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i3-ipUSEPR-TR657
Plasmid#228929PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i3 (Trp53 Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K164R)
Plasmid#72555PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K164R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK164RPromoterE1B minimal promoterAvailable SinceMarch 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P2-p53 (1-90) (72R)
Plasmid#62081PurposeExpression of human p53 (TAD residues 1-90) (72R) in e. coliDepositorInsertp53 (TP53 Human)
TagsGSTExpressionBacterialMutationContains TAD/PP residues 1-90, 72RPromotertacAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R)
Plasmid#72554PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120RPromoterE1B minimal promoterAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
sg_Trp53_i4-ipUSEPR-TR657
Plasmid#228930PurposeKnockdown of Trp53 in mammalian cellsDepositorInsertsg_Trp53_i4 (Trp53 sequence: GTCGCTACCTACAGCCAGGA, Mouse)
UseLentiviralAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGLS3-5xHRE-p53(K120R/K164R)
Plasmid#72556PurposeHypoxia induced mutant p53. Contains the HRE from VEGF sequence (5 repeats) upstream of p53 K120R/K164R.DepositorInsertp53 (TP53 Human)
Tags5XHREExpressionMammalianMutationK120R/K164RPromoterE1B minimal promoterAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET28-p53 (1-90) (72P)
Plasmid#62080PurposeExpression of human p53 (1-90) (72P) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationcontains TAD/PP residues 1-90; 72PPromoterT7Available SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
phBG-P53DD
Plasmid#149707PurposeIn vitro transcription of dominant negative form of P53 mRNA for RNA transfection into mammalian cellsDepositorAvailable SinceJune 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (P12A P13A)
Plasmid#62066PurposeExpression of human p53 (residues 1-73) (P12A, P13A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; P12A, P13APromoterT7Available SinceFeb. 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (P to A)
Plasmid#62069PurposeExpression of human p53 (1-73) (all P to A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; all Prolines changed …PromoterT7Available SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (P27A)
Plasmid#62068PurposeExpression of human p53 (1-73) (P27A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; P27APromoterT7Available SinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
pENTR-p53DD-IRES-HRAS(G12V)
Plasmid#233188PurposeGateway entry vector for p53DD and HRAS(G12V) (DDIR)DepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (PPP)
Plasmid#62067PurposeExpression of human p53 (1-73) (P12A, P13A, P27A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; P12A, P13A, P27APromoterT7Available SinceJan. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNluc-sgControl
Plasmid#208383PurposeThis sgControl, located in the TP53BP1 intron, serves as a control sgRNA for the others. The vector was cloned from Lenti-sgRNA-Cre-GpNLuc.DepositorInsertsgControl (TP53BP1 intron) (Trp53bp1 Mouse)
UseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-3XHA-p53
Plasmid#196267PurposeMammalian expression of 3xHA tagged wild-type p53DepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SNAP-p53DD-IRES-HRAS(G12V)-bGH
Plasmid#233204PurposeAAV expression of SNAP-p53DD and HRAS(G12V)DepositorUseAAVExpressionMammalianMutationG12VAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-HRAS(G12V)-IRES-SNAP-p53DD
Plasmid#233200PurposeRetroviral expression of HRAS(G12V) and SNAP-p53DDDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-SNAP-p53DD-IRES-HRAS(G12V)
Plasmid#233198PurposeRetroviral expression of SNAP-p53DD and HRAS(G12V)DepositorAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-HRAS(G12V)-IRES-p53DD
Plasmid#233185PurposeRetroviral expression of HRAS(G12V) and p53DD (RIDD)DepositorUseRetroviralExpressionMammalianMutationG12VAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
p53 S23A targeting vector
Plasmid#12167DepositorInsertp53 (Trp53 Mouse)
UseCre/LoxExpressionMammalianMutationSer23 mutation (S23A) in exon 2 and puromycin gen…Available SinceJune 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pENTR-SNAP-p53DD-IRES-HRAS(G12V)
Plasmid#233201PurposeGateway entry vector for SNAP-p53DD and HRAS(G12V)DepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW-SNAP-p53DD-IRES-HRAS(G12V)
Plasmid#233206PurposeLentiviral dox-inducible expression of SNAP-p53DD and HRAS(G12V)DepositorUseLentiviralExpressionMammalianMutationG12VAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-HRAS(G12V)-IRES-SNAP-p53DD
Plasmid#233199PurposeGateway entry vector for HRAS(G12V) and SNAP-p53DDDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-HRAS(G12V)-IRES-p53DD
Plasmid#233186PurposeGateway entry vector for HRAS(G12V) and p53DD (RIDD)DepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only